We narrowed to 11,666 results for: 110
-
Plasmid#51847Purposeencodes a CHES1 mRNA that is resistant to shRNA against CHES1DepositorInsertCHES1 (FOXN3 Human)
UseRetroviralAvailable SinceJuly 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
p172 Dync1i2.E (Ex 1b)
Plasmid#26442DepositorInsertcytoplasmic dynein 1 intermediate chain 2 isoform E (exon 1b) (Dync1i2 Mouse)
UseSubcloning and sequencingMutationN/AAvailable SinceMarch 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pADH100Cau
Plasmid#244817PurposeModified plasmid from pADH100 to perform HIS-FLP CRISPR in Candidozyma aurisDepositorInsertSNR52p from C. auris
UseCRISPRTagsHIS1 terminator from C. auris and NAT resistance …ExpressionYeastPromoterSNR52pAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pADH99Cau
Plasmid#244807PurposeModified plasmid from pADH99 to perform HIS-FLP CRISPR in Candidozyma aurisDepositorInsertCauHIS1_US
UseCRISPRTagsC. albicans MAL2 promoter, C. albicans codon opti…ExpressionYeastAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
hPSD-95_PDZ3
Plasmid#245905PurposeBacterial expression of PSD-95 PDZ3 domain (302-402)DepositorAvailable SinceOct. 23, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
hPSD-95_PDZ2
Plasmid#245904PurposeBacterial expression of PSD-95 PDZ2 domain (155-249)DepositorAvailable SinceOct. 23, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDonr 201_MGA
Plasmid#240327PurposeEntry vector for Gateway with MGADepositorInsertMGA (MGA Human)
ExpressionBacterialAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBOB-HA-Gnaq
Plasmid#246001PurposeExpress HA N-terminal tagged mouse Galphaq transiently via transfection or stably via lentivirus-mediated infection in mammalian cells.DepositorAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_FOidr_177
Plasmid#244729PurposeExpress mEGFP-tagged intrinsically disordered protein (IDR), FOidr_177, derived from human fusion protein SLC16A14_SP110DepositorInsertFOidr_177
Tagsmonomeric EGFPExpressionMammalianMutationUnmutatedAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-AHR-shRNA3
Plasmid#166909PurposeLentivirus for inducible knockdown of human AHRDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZNpF-∆11cag
Plasmid#245370PurposeDual luciferase (nano, firefly) with Zfp423 5' end fused to NanoLuciferaseDepositorInsertZfp423-∆11cag (Zfp423 Mouse)
UseLuciferase and Synthetic BiologyTagsNanoLuciferaseExpressionMammalianMutation11-bp deletion, H96Wfs*4, plus 3 synonymous mutat…PromoterEF1aAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZNpF-∆7cg
Plasmid#245371PurposeDual luciferase (nano, firefly) with Zfp423 5' end fused to NanoLuciferaseDepositorInsertZfp423-∆7cg (Zfp423 Mouse)
UseLuciferase and Synthetic BiologyTagsNanoLuciferaseExpressionMammalianMutation7-bp deletion, H96Vfs*29, plus 2 synonymous mutat…PromoterEF1aAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-Nsp3(1-111)
Plasmid#242947PurposeGFP and the Ubl1 domain of the SARS-CoV-2 Nsp3 protein (aa 1-111)DepositorAvailable SinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT-Myc-BirA*G3
Plasmid#240233PurposeExpression of Myc-BirA*-G3 under control of copper-inducible promoter. Can be used to generate stable cell lines by Hygromycin selection.DepositorInsertMyc-BirA*G3
ExpressionInsectPromoterMTAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR_CG6867_nostop
Plasmid#240238PurposeGateway entry clone with CG6867 without stop codonDepositorInsertCG6867 (CG6867 Fly)
UseGateway shuttle vectorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only