We narrowed to 5,408 results for: U6
-
Plasmid#117553PurposeLevel1 Golden Gate Cassette: sgRNA cassette for spCas9, targeting NbPDS gene in N. benthamianaDepositorInsertPromoter_AtU6-26 + sgRNA_NbPDS1 N. benthamiana
ExpressionPlantPromoterAt U6-26 (pICSL90002)Available SinceNov. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
TGIF2 A11.3 gRNA
Plasmid#90910Purpose3rd generation lentiviral gRNA plasmid targeting human TGIF2DepositorInsertTGIF2 (Guide Designation A11.3)
UseCRISPR and LentiviralPromoterU6Available SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
p236_LTJ_sgRNAFoxp3sf/J
Plasmid#82676PurposesgRNA targeting murine Foxp3 scurfy. Co-expresses SpCas9-2A-EGFP.DepositorInsertsgRNA targeting Foxp3 sf/J
UseCRISPRExpressionMammalianPromoterU6Available SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR sgAMDHD1
Plasmid#102316Purposegenetic depletion of AMDHD1DepositorAvailable SinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV(shRNA)-Puro-6 CCEPR Vb2
Plasmid#108278PurposeshRNA for CCEPR lncRNADepositorAvailable SinceApril 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTE3179
Plasmid#107528PurposeExpresses Mb crRNA and mCherry in mammalian cells.DepositorInsertsMb crRNA
mCherry
ExpressionMammalianPromoterCBh and human U6Available SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-shScn4b-268
Plasmid#99031PurposeExpresses a shRNA targeting the mouse Scn4b geneDepositorAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only