We narrowed to 2,557 results for: GCG
-
Plasmid#217340PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertsUseCRISPR and LentiviralPromoterhU6Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only
-
UAS-4x(tRNA::hiw{sgRNA})
Plasmid#187884PurposeGal4/UAS sgRNA expression targeting hiwDepositorInsert4 sgRNAs targeting hiw
Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUDP044
Plasmid#101168PurposepUDP004 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes SeATF1 and SeATF2 and Spcas9D147Y P411T in S. pastorianus (HH-gRNASeATF1-HDV-linker-HH-gRNASeATF2-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting SeATF1 and 2 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-HHIP
Plasmid#185551PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting HHIPDepositorInsertHHIP gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUDP123
Plasmid#107269PurposepUDP123 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes OpADE2 and OpNIAD and Spcas9D147Y P411T in O. parapolymorpha (HH-gRNAOpADE2-HDV-linker-HH-gRNAOpNIAD-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting OpADE2 and NIAD in O. parapolymorpha
ExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV CAG Barcode4
Plasmid#229065PurposeExpression mappingDepositorInsertCAG Barcode4
UseAAVAvailable SinceDec. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode17
Plasmid#226190PurposeExpression mappingDepositorInsertSyn Barcode17
UseAAVAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ERF922
Plasmid#126883PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ ERF922
Plasmid#126893PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgNT-hU6-sgSnrk
Plasmid#177236PurposeExpresses neomycin (bU6), non-targeting (mU6) and Snrk (hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgNT1/sgSnrk
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgNT-hU6-sgLkb1_2nd
Plasmid#177230PurposeExpresses Neomycin(bU6), non-targeting (mU6) and Lkb1 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgNT1/sgLkb1_2nd
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgLkb1_2nd-hU6-sgNT
Plasmid#177229PurposeExpresses Neomycin (bU6), Lkb1 (mU6) and non-targeting(hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgLkb1_2nd/sgNT1
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgLkb1_2nd-mU6-sgNeo1-hU6-sgNT
Plasmid#177228PurposeExpresses Lkb1(bU6), neomycin (mU6) and non-targeting(hU6) gRNAs and Cre-recombinaseDepositorInsertsgLkb1_2nd/sgNeo1/sgNT1
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Sptbn4 Donor;3xV5 KO;Nfasc
Plasmid#240296PurposeKI:Sptbn4 Donor:3xV5 KO:NfascDepositorInsertKI gRNA for Sptbn4
UseAAVMutationNAAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hGSDMD
Plasmid#185377PurposeFor mammalian expression of guide RNA: CGCGCCAGACGCGCCACCCT that targets human GSDMD (Gasdermin D)DepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYTP MYRF sg1
Plasmid#88857PurposepAC154-dual-dCas9VP160-sgExpression with MYRF sg1 cloned into BbsI siteDepositorAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTP MYRF sg2
Plasmid#88858PurposepAC154-dual-dCas9VP160-sgExpression with MYRF sg2 cloned into BbsI siteDepositorAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AksgRNA
Plasmid#121955PurposeMammalian expression, Genome editing, gRNA scaffoldDepositorInsertAkCas12b single chimeric gRNA
ExpressionMammalianAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS161
Plasmid#215683PurposeGuide only plasmid targeting chrIII split hygromycinR landing padDepositorInsertU6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
Col7A1-CRISPR-gRNA#exon2-(pSpCas9(BB)-2A-Puro (PX459) V2.0)
Plasmid#124286PurposesgRNA against human Col7A1DepositorInsertCollagen type VII alpha 1 chain (COL7A1 Human)
UseCRISPRAvailable SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGG184
Plasmid#165604PurposeReporter plasmid for B1H-dependent expression of the HIS3/GFP operon with a single hEGFP protospacer: PS1(upstream of promoter with 'CAGCG' PAM)-lac-HIS3 and GFPDepositorInserthEGFP protospacer ('CAGCG' PAM) upstream of the HIS3/GFP promoter
UseSynthetic BiologyExpressionBacterialMutation'CAGCG' PAM replacing the 'CGGCG…PromoterlacAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
UAS-4x(tRNA::axed{sgRNA})
Plasmid#187883PurposeGal4/UAS sgRNA expression targeting axedDepositorInsert4 sgRNAs targeting axed
Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
UAS-4x(tRNA::dsarm{sgRNA})
Plasmid#187885PurposeGal4/UAS sgRNA expression targeting dsarmDepositorInsert4 sgRNAs targeting dSarm
Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056H
Plasmid#183135PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056J
Plasmid#183136PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
RRM2 E3.3 gRNA
Plasmid#90882Purpose3rd generation lentiviral gRNA plasmid targeting human RRM2DepositorInsertRRM2 (Guide Designation E3.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only