We narrowed to 24,431 results for: nes
-
Plasmid#10934DepositorInsertPTEN (PTEN Human)
UseTagsHA and NESExpressionMammalianMutationG129RPromoterAvailable sinceJan. 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
R4pGWB601_UBQ10p-BirA(R118G)-NES-YFP
Plasmid#127363PurposeBinary vector for expressing cytosolic BirA* (R118G)-YFP under the UBQ10 promoter in plantsDepositorInsertBirA* (R118G mutant)
UseTagsGS linker, NES, V5, and YFPExpressionPlantMutationR118GPromoterArabidopsis UBQ10 promoterAvailable sinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorInsertAICD-NES (APP Human)
UseAAVTagsExpressionMutationNonePromoterCMVAvailable sinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-mCherry-PKAsub-RLuc8N-NES
Plasmid#138211PurposeEncodes substrate fragment of luminescence-based bimolecular PKA activity reporter (LumAKAR); cytosol targeted. Use in conjunction with pcDNA3-RLuc8C-FHA1-NES.DepositorInsertmCherry-PKAsub-RLuc8N-NES
UseTags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianMutationPromoterCMVAvailable sinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-myc NES- mCE(K294A)
Plasmid#82464PurposeExpresses myc tag and catalytic inactive form of mRNA capping enzyme with N terminal Nuclear export signal (NES)DepositorInsertNES mRNA capping enzyme (Rngtt Mouse, HIV)
UseTagsmycExpressionMammalianMutationK294APromoterCMVAvailable sinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-bio-myc-NES-EGFP
Plasmid#112712PurposeFor tetracycline-inducible expression of bio-myc-NES-EGFP in mammalian cellsDepositorInsertEGFP
UseTagsHIV Rev nuclear localization signal (NES), biotin…ExpressionMammalianMutationNucleotide sequence optimized for synthetic gene …PromoterCMV with Tet repressor binding sitesAvailable sinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-NES-SomaFRCaMPi
Plasmid#232836PurposeAAV transfer plasmid for CAG-mediated Cre-dependent expression of soma-targeted FRCaMPiDepositorInsertNES-FRCaMPi (NES Synthetic)
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-NUP98n-CAGEn-NES (Nrdj1)
Plasmid#241418PurposeProximity-triggered Protein Trans-Splicing to generate the splice product MLL-AF9, Figure 2 & Extended Figure 4 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorInsertNUP98n-CAGEn-NES (Nrdj1) (NUP98 Synthetic, Human)
UseTagsMycExpressionMammalianMutationPromoterCMVAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CaMKII-RFP-p2A-DAAO-NES
Plasmid#238918PurposeMammalian expression of DAAO with a nuclear export signal and RFP as a reporter in excitatory neuronsDepositorInsertRFP-p2A-DAAO-NES
UseAAVTagsExpressionMammalianMutationPromoterCaMKIIalfaAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CMV-RFP-p2A-DAAO-NES
Plasmid#238920PurposeExpression of DAAO with a nuclear export signal and RFP as a reporter in mammalian cellsDepositorInsertRFP-p2A-DAAO-NES
UseAAVTagsExpressionMammalianMutationPromoterCMVAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only