We narrowed to 5,948 results for: crispr cas9 expression plasmids
-
Plasmid#229960PurposebigMamAct is evolution of biGBac for mammalian cells. psBIG plasmids are recipient of multi-assembly step by Gibson cloningDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only
-
psBIG1e
Plasmid#229961PurposebigMamAct is evolution of biGBac for mammalian cells. psBIG plasmids are recipient of multi-assembly step by Gibson cloningDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
psBIG1c
Plasmid#229959PurposebigMamAct is evolution of biGBac for mammalian cells. psBIG plasmids are recipient of multi-assembly step by Gibson cloningDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPomyces-2BD
Plasmid#234428PurposePlasmid for Streptomyces containing gene of modified Cas9-BD protein and sequence of sgRNA cloning templateDepositorInsertModified Cas9 with polyaspartate linking
ExpressionBacterialMutationLinked polyaspartate using glycine-serine linkerAvailable SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag NtDRMcd (noNLS) nog
Plasmid#119554PurposeCRISPR-Cas9 SunTag system to target NtDRMcd (without an NLS) to specific loci of interest (nog=no guide)DepositorInsertNOS_NLS_GB1_noNLS_linker_DRMcd_linker sfGFP_scFv_UBQ10_Insulator UBQ10_Ω dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag NtDRMcd g4+g10+g18 (FWA)
Plasmid#115487PurposeCRISPR Cas9 SunTag system to target NtDRMcd to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_NOS_NLS_GB1_NLS_linker_DRMcd_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag NtDRMcd (no NLS) SUP
Plasmid#115490PurposeCRISPR-Cas9 SunTag system to target NtDRMcd (without an NLS) to the SUPERMAN locus with two guide RNAsDepositorInsertg2_U6_g1_U6_NOS_NLS_GB1_noNLS_linker_DRMcd_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEG302 5aa SunTag VP64 g4+g17 (FWA)
Plasmid#119672PurposeCRISPR-Cas9 SunTag system to target VP64 to the FWA locus with two guide RNAsDepositorInsertg17_U6_g4_U6_NOS_NLS_GB1_NLS_linker_VP64_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_2xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCBC-DT1T2
Plasmid#50590PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT1, U626t plus, U629p, T2
UseCRISPR; Pcr templateExpressionPlantAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCBC-DT2T3
Plasmid#50591PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT2, gRNA scaffold, U6-29t plus, U6-1p, T3
UseCRISPR; Pcr templateExpressionPlantAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCBC-DT3T4
Plasmid#50592PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT3, gRNA scaffold, U6-1tplus, U6-26p, T4
UseCRISPR; Pcr templateExpressionPlantAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLenti SpBsmBI sgRNA Puro
Plasmid#62207PurposeAn empty sgRNA expression vector for expression of sgRNA for Sp Cas9 (3rd generation lentiviral vector)DepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterU6Available SinceMay 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP2443
Plasmid#72252PurposeHuman expression plasmid for SpCas9-VRQR-HF1 variant: CMV-T7-humanSpCas9-VRQR-HF1(N497A, R661A, Q695A, Q926A, D1135V, G1218R, R1335Q, T1337R)-NLS-3xFLAGDepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 VRQR-HF1(N497A/R661A/Q695A/Q926A/D1135V/G1218R/R1335Q/T1337R)-NLS-3xFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926A, D1135V, G1218R, R1335…PromoterCMVAvailable SinceJan. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSP2440
Plasmid#72250PurposeHuman expression plasmid for SpCas9-VQR-HF1 variant: CMV-T7-humanSpCas9-VQR-HF1(N497A, R661A, Q695A, Q926A, D1135V, R1335Q, T1337R)-NLS-3xFLAGDepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 VQR-HF1(N497A/R661A/Q695A/Q926A/D1135V/R1335Q/T1337R)-NLS-3xFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926A, D1135V, R1335Q, and T…PromoterCMVAvailable SinceJan. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag3-gRNA3
Plasmid#196254PurposePlasmid for cloning the third CRISPR-Cas9 guide RNA of 4 guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag2-gRNA2
Plasmid#196252PurposePlasmid for cloning the second CRISPR-Cas9 guide RNA of multiplex guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag1-gRNA1
Plasmid#196251PurposePlasmid for cloning the first CRISPR-Cas9 guide RNA of multiplex guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag4-gRNA4
Plasmid#196255PurposePlasmid for cloning the 4th CRISPR-Cas9 guide RNA of 4 guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
LRG (Lenti_sgRNA_EFS_GFP)
Plasmid#65656PurposeLentiviral introduction of sgRNA constitute expression linked with GFP marker into mammalian cell line.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 promoter-driven sgRNA expression and EFS promo…Available SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMTF1.1.0-gDNA
Plasmid#113797PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor MTF1DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZBTB9.1.0-gDNA
Plasmid#112469PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZBTB9DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZBTB5.1.0-gDNA
Plasmid#112399PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZBTB5DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZFX.1.0-gDNA
Plasmid#112462PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZFXDepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF436.1.0-gDNA
Plasmid#113767PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF436DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXD1.1.0-gDNA
Plasmid#112446PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor MXD1DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUSF2.1.0-gDNA
Plasmid#112457PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor USF2DepositorAvailable SinceApril 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZNF331.1.0-gDNA
Plasmid#112461PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF331DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVEZF1.1.0-gDNA
Plasmid#112437PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor VEZF1DepositorAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF416.1.0-gDNA
Plasmid#112468PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF416DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only