We narrowed to 13,645 results for: sequence
-
Plasmid#186356PurposeEntry clone with ORF encoding plasma membrane-targeted GAP43-eCFP flanked by Gateway recombination sequencesDepositorInsertGrowth-associated protein-43 (Gap43 Mouse, Synthetic)
UseExpression of a fluorescent membrane markerTagsECFPAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_1136200-bio
Plasmid#47730PurposeExpresses enzymatically monobiotinylated full-length PF3D7_1136200 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised PF3D7_1136200
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin replaced…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
Lrrc4c-Fc-His
Plasmid#72085PurposeExpresses the extracellular region of the LRRC4C protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-Chrna5-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128340PurposepAAV encoding gRNA sequence for loss-of-function indelsDepositorAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGFP-PTEN C124A
Plasmid#50520PurposeThis plasmid contains GFP21, which has a sequence similar to YFP, but emission/excitation similar to GFP.DepositorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
human ETV6 gRNA-1
Plasmid#133353Purposehuman ETV6 gRNA-1 is a gRNA expression plasmid. Its 20-nt specific sequence targets the first ETV6 exon.DepositorAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
UbG76V-eGFP-V5His_15aa
Plasmid#23969DepositorInsertUb-G76V-eGFP-V5HIS_15aa (UBB Human)
TagseGFPExpressionMammalianMutationG76V mutation in Ubiquitin. Ub fused to N-termin…Available SinceApril 16, 2010AvailabilityAcademic Institutions and Nonprofits only -
pMT-ubb-Avi-Cerulean-Rpl10a
Plasmid#79882PurposeUbiquitin promoter driving Avi-tagged protein containing Cerulean protein fused to zebrafish Rpl10a ribosomal unit (Tryon et al. 2012); flanked by Tol2 sequencesDepositorInsertCerulean protein fused to zebrafish Rpl10a ribosomal unit (rpl10a Zebrafish)
TagsAviExpressionBacterialPromoterUbiquitinAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
FLAG-HA-BLMP-1-pcDNA3.1-
Plasmid#52512Purposeexpresses C. elegans BLMP-1 in mammalian cells with FLAG-HA tag at N-terminusDepositorInsertBlmp-1 (blmp-1 Nematode)
TagsFLAG-HAExpressionMammalianMutationN75S mutation compared GenBank reference sequence…PromoterCMVAvailable SinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMTB2-cytoBirA-2A-mCherry_Ras
Plasmid#80066PurposeBeta-actin2 promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterBeta-actin2Available SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
KCC2-pHext
Plasmid#104076PurposeTo visualize the expression and localization of potassium-chloride cotransporter type 2 (KCC2)DepositorInsertKCC2 (b isoform) (Slc12a5 Rat)
TagspHluorine tag inserted in the second putative tra…ExpressionMammalianMutationEcoR1 site in rat KCC2 was removed by silent muta…PromoterUbCAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pAct-AtINTphiC31
Plasmid#127535PurposePlasmid encodes A. thaliana codon optimized Integrase phiC31.DepositorInsertIntegrase phiC31 coding sequence codon optimized for A. thaliana expression.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTol2CG NBT:NRGIIIa:polyA
Plasmid#193012PurposeTol2 transgenic construct that will express human Neuregulin1 Type IIIa in neuronsDepositorAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJZC32
Plasmid#62327PurposesgRNA (no RNA aptamer addition) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
ZIKV_Trigger_32B
Plasmid#75009PurposePortion of Zika Virus genome (KU312312: 7166-7299) containing sensor 32B trigger sequenceDepositorInsertZIKV_Trigger_32B
ExpressionBacterialPromoterT7Available SinceMarch 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR-ABCF2_STOP
Plasmid#221425PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertABCF2 (ABCF2 Human)
ExpressionMammalianAvailable SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
Flrt1-Fc-His
Plasmid#72073PurposeExpresses the extracellular region of the FLRT1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
MEF2A-Sensor
Plasmid#208928Purposein vitro MAPK-Sensor for luminescent detection of ERK and p38-activityDepositorInsertMef2a docking sequence+Phospho site (MEF2A Human)
TagsHISx6, MBP, and SmbitExpressionBacterialPromoterT7Available SinceApril 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pAct-AtINT13
Plasmid#127534PurposePlasmid encodes A. thaliana codon optimized Integrase 13.DepositorInsertIntegrase 13 coding sequence codon optimized for A. thaliana expression.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
Sema4d-Fc-His
Plasmid#72157PurposeExpresses the extracellular region of the Sema4D protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only