We narrowed to 15,723 results for: grna
-
Plasmid#119258Purposerfp "test" strainDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1071
Plasmid#119245Purposerfp "test" strainDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1170
Plasmid#119252Purposerfp "test" strainDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132D2.0
Plasmid#99890PurposeGolden Gate entry vector to express the 2nd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under OsU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterOsU3Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC CBA-SpCas9N863Anickase.EF1a-BFP.sgLMNApair1
Plasmid#98976PurposeCas9 Homologous Recombination Reporter. SpCas9N863A nickase and a pair of sgRNAs targeting hLMNA. Generates breaks with 44bp 3' overhangs. TagBFP.DepositorInsertLMNA sgRNAs pair 1 and Cas9(N863A)
ExpressionMammalianAvailable SinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC CBA-SpCas9D10Anickase.EF1a-BFP.sgLMNApair1
Plasmid#98972PurposeCas9 Homologous Recombination Reporter. SpCas9D10A nickase and a pair of sgRNA targeting hLMNA. Generates breaks with 44bp 5' overhangs. TagBFP.DepositorInsertLMNA sgRNAs pair 1 and Cas9(D10A)
ExpressionMammalianAvailable SinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
B52 + SPRTN sgSTOP
Plasmid#100709PurposeB52 plasmid expressing SPRTN sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting SPRTN (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC73
Plasmid#62341PurposesgRNA (no RNA aptamer addition) with COM-KRAB effector for mammalian cellsDepositorInsertssgRNA
COM-KRAB
UseLentiviralTagsKRABExpressionMammalianMutationTargets sv40 promoter, sequence: GAATAGCTCAGAGGCC…PromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAL10
Plasmid#236006PurposeBackbone for assembling gRNA arrays with LacZ gene for blue white screeningDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV_A2S-8
Plasmid#188654PurposeAAV vector expressing SaAID-2S and gRNADepositorInsertsAID2S--nSaCas9-UGI
Sa-sgRNA
UseAAV and CRISPRTagsUGIExpressionMammalianMutationD10A for SaCas9PromoterScp1 and U6Available SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDYSCKO-ADE1
Plasmid#120264PurposepDYSCKO canavanine co-selection vector with a guide targeting the ADE1 locusDepositorInsertpDYSCKO cassette-ADE1 targeting guide
UseCRISPR and Synthetic BiologyPromoterSNR52Available SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDYSCKO
Plasmid#120263PurposeEmpty backbone for cloning any gRNA to be used with the canavanine co-selection systemDepositorInsertDYSCKO cassette
UseCRISPR and Synthetic BiologyPromoterSNR52Available SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry TFRC_B
Plasmid#78544PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 and U6 (for expressing sgRNA)Available SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry MALAT1_Exon.4
Plasmid#78543PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 and U6 (for expressing sgRNA)Available SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry MALAT1_Exon.2
Plasmid#78541PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 (for expressing sgRNA) and U6 promoterAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3A2
Plasmid#73435PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3A2.DepositorInsertRepressor 3A2 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-Cas9/CD4-TK2
Plasmid#104397PurposeThe designed sgRNA cloned into this plasmid directs the specific DNA cleavage exerted by Cas9 nuclease in a region of exon 5 of the human TK2 gene. The plasmid also includes the Cas9 nuclease and CD4.DepositorAvailable SinceApril 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12R/sgKras/Cre
Plasmid#99852PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12R mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLRK36
Plasmid#253105PurposeExpresses SpCas9-P2A-RUBY under ZmUbi1 promoter and two gRNAs for targeting NAC21/22 genes in wheatDepositorInsertSpCas9-P2A-RUBY
UseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbi1Available SinceMay 15, 2026AvailabilityAcademic Institutions and Nonprofits only