We narrowed to 1,054 results for: Psp
-
Plasmid#85571PurposeExpresses sgRNA targeting human AAVS1 locusDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
AOI-WT-Cas9-sg-mouse Suz12-F2-GFP
Plasmid#91882PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Suz12DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
EHMT1_exon 3_gRNA
Plasmid#228809PurposeCRISPR targeting of human EHMT1DepositorAvailable SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
B2M-SDMutation-gRNA
Plasmid#215547PurposegRNA targeting B2M to introduce splice donor mutation on the first intron of the locusDepositorInsertB2M (B2M Human)
UseCRISPRAvailable SinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
INS-3'gRNA
Plasmid#210468PurposegRNA targeting INS 3' terminal for CRISPR-Cas9-mediated knock-inDepositorInsertINS (INS Human)
UseCRISPRAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBS10-riboE-dddAI
Plasmid#186561PurposeRegulated expression of the DddA immunity determinant (DddAI) in FirmicutesDepositorInsertdddAI
ExpressionBacterialPromoterpSpac(hy)Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
rd
Plasmid#112912PurposeExpress the PEST domain-replaced 48 kDa form of human dematin with a cleavable N-terminal GST tagDepositorInsertdematin (DMTN Human)
TagsGlutatione-S-Tranferase and precision protease si…ExpressionBacterialMutationPEST sequence near the N-terminal removed. 5′-GCG…PromoterT7Available SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX458-sgTSC2
Plasmid#128098PurposeCRISPR gRNA against human TSC2 with Cas9 from S. pyogenes and 2A-EGFPDepositorAvailable SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX459v3
Plasmid#178799PurposeSpCas9 with 2A-Puro, and a golden gate cloning backbone for sgRNA. sgRNA scaffold seqeuence has been modified for increased sgRNA expression (v3).DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
CDKN1A (p21) targeting gRNA
Plasmid#215319PurposeExpresses gRNA targeting CDKN1A (p21) and pSpCas9(BB)-2A-GFP in mammalian cells from the px458 vector.DepositorInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-CTNNB1-ATG
Plasmid#153429PurposeExpresses a gRNA that overlaps the startcodon of human CTNNB1DepositorAvailable SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX459-CTNNB1-S45
Plasmid#164587PurposeExpresses a gRNA that overlaps the S45 codon of human CTNNB1DepositorAvailable SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLIK-NFLAG-hFUS
Plasmid#50487PurposeProduces lentivirus expressing human FUS with FLAG tag at its N-terminus by co-transfection with psPAX2 and pMD2GDepositorAvailable SinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
CCND2 targeting gRNA
Plasmid#215318PurposeExpresses gRNA targeting CCND2 and pSpCas9(BB)-2A-GFP in mammalian cells from the px458 vector.DepositorInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
CCND1 targeting gRNA
Plasmid#215153PurposeExpresses gRNA targeting CCND1 and pSpCas9(BB)-2A-GFP in mammalian cells from the px458 vector.DepositorInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgMTOR_49
Plasmid#125132PurposeTargeting 49th exon of human MLST8 gene by CRISPR-Cas9DepositorAvailable SinceMay 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgSf3b1(T1)
Plasmid#90424Purposeinduces dsDNA break within mouse Sf3b1 gene for subsequent homology-directed recombination and coding sequence mutagenesis at codon 700DepositorInsertmus Sf3b1 gRNA (Sf3b1 Mouse)
UseCRISPR; Guiderna encoding for gene editingExpressionMammalianPromoterU6Available SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
rd-his
Plasmid#112911PurposeExpress the PEST domain-replaced 48 kDa form of human dematin with a cleavable N-terminal GST tag and non-cleavable C-terminal 6-his tagDepositorInsertdematin (DMTN Human)
Tags6-his tag, Glutathione-S-Transferase, and preciss…ExpressionBacterialMutation89KSTSPPPSPEVWAD102 was replaced with 89KAAAGGGAG…PromoterT7Available SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only