We narrowed to 5,837 results for: dna plasmids
-
Plasmid#89346Purpose2nd generation lentiviral vector which expresses SNAP tagged TCRbeta subunit upstream of a IRESpuro cassetteDepositorInsertTCR beta gene (Jurkat allele) fused at the N terminus to the SNAP tag
UseLentiviralTagsSNAPf tagExpressionMammalianPromoterSFFVAvailable SinceJune 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HCMVgH (Merlin)
Plasmid#136448PurposeMammalian expression plasmid for HCMV glycoprotein H (Merlin strain), full-lengthDepositorInsertglycoprotein H (UL75 Human betaherpesvirus 5)
ExpressionMammalianMutationCodon-optimized for human cell expression.PromoterCMVAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.0_LynSNAP IRES EGFP
Plasmid#136625PurposePlasmid encoding outer inner membrane localization of SNAP-Tag and EGFPDepositorInsertLyn11-SNAP-Tag (IRES EGFP)
ExpressionMammalianPromoterCMVAvailable SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Gα13(EE)-YFP
Plasmid#171374PurposePlasmid encoding Gα13 internally-tagged with the Citrine variant of YFP in the b/c loopDepositorInsertGa13(EE)-YFP
TagsGlu-GluExpressionMammalianPromoterCMVAvailable SinceNov. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.1_SM-FLuc0-malat1
Plasmid#210580PurposeExpresses SM(FLAG)-nonoptimal Firefly - 3'UTR malat1 triple helixDepositorInsertSpaghetti monster (FLAG)-nonoptimal FLuc - 3'UTR malat1 triple helix
UseLuciferaseTagsSpaghetti monster (FLAG)ExpressionMammalianPromoterCMVAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_SM-FLuc100-malat1
Plasmid#210581PurposeExpresses SM(FLAG)-optimal Firefly luciferase - 3'UTR malat1 triple helixDepositorInsertSpaghetti monster (FLAG)-optimal FLuc - 3'UTR malat1 triple helix
UseLuciferaseTagsSpaghetti monster (FLAG)ExpressionMammalianPromoterCMVAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ spike_del19
Plasmid#155297PurposeExpression of spike with C-term deletion of 19 aa, used to generate high efficiency SARS-CoV-2-pseudotyped lentiviral particlesDepositorInsertSARS-Cov2 spike_deleted (S SARS-Cov2)
UseGeneration of sars-cov-2-pseudotyped lentiviral p…MutationDeletion in C-term 19 aa of spikePromoterCMVAvailable SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.1-tvD-Cit-tevs-DHFR
Plasmid#116054PurposeReporter plasmid for measuring protease activityDepositorInserttvD-Cit-tevs-DHFR
ExpressionMammalianAvailable SinceOct. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CMV-SV40NLS-OgeuIscBE193A-3XHA
Plasmid#222861PurposeThis plasmid codes for the OgeuIscB nickaseDepositorInsertOgeuIscB Nickase
UseCRISPRTags3X HA and Nucleoplasmin NLS and ITR2ExpressionMammalianMutationE193A for nickase mutationPromoterCMVAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+-Tornado-split-nLuc
Plasmid#212612PurposeFor the expression of a split nLuc that produces luminescence only when circularized. To test your IRES of interest, clone into the EcoRI, BsiWI sites.DepositorInsertTornado-CVB3-split-nLuc
UseLuciferaseExpressionMammalianMutationC373T mutation in CVB3PromoterCMVAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+-mutTornado-split-nLuc
Plasmid#212707PurposeTornado split nLuc with a mutated 3' ribozyme so that circularization cannot occur.DepositorInsertmutTornado-CVB3-split-nLuc
MutationDeleted the partial 3'ribozyme sequence in T…Available SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CarO-BFP2-TSERex
Plasmid#124795PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertCarO-BFP2
ExpressionMammalianPromoterCAGAvailable SinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Mac-BFP2-TSERex
Plasmid#124793PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertMac-BFP2
ExpressionMammalianPromoterCAGAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT/TO MycLAP-STIL
Plasmid#80266Purposemammalian expression plasmid for MycLAP-STILDepositorAvailable SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Tras light chain
Plasmid#216294PurposeExpresses anti-HER2 Tras Light chain in mammalian cells. To be paired with Tras heavy chain to form the anti-HER2 Tras FabDepositorInsertTras light chain
UseAffinity Reagent/ AntibodyTagsSignal peptideExpressionMammalianPromoterT7 promoterAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Pert Light chain
Plasmid#216310PurposeExpresses anti-HER2 Pert Light chain in mammalian cells. To be paired with Pert heavy chain to form the anti-HER2 Pert FabDepositorInsertPert Light chain
UseAffinity Reagent/ AntibodyTagsSignal peptideExpressionMammalianPromoterT7 promoterAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Char-BFP2-TSERex
Plasmid#124792PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertChar-BFP2
ExpressionMammalianPromoterCAGAvailable SinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-39S Light chain
Plasmid#216297PurposeExpresses anti-HER2 39S Light chain in mammalian cells. To be paired with 39S heavy chain to form the anti-HER2 39S FabDepositorInsert39S Light chain
UseAffinity Reagent/ AntibodyTagsSignal peptideExpressionMammalianPromoterT7 promoterAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-MF3958 Light chain
Plasmid#216304PurposeExpresses anti-HER2 MF3958 Light chain in mammalian cells. To be paired with MF3958 heavy chain to form the anti-HER2 MF3958 FabDepositorInsertMF3958 Light chain
UseAffinity Reagent/ AntibodyTagsSignal peptideExpressionMammalianPromoterT7 promoterAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only