We narrowed to 13,645 results for: sequence
-
Plasmid#66856PurposeExpress FLAG-tagged C.elegans WTS-1 in mammalian cellsDepositorInsertWTS-1 (wts-1 Nematode)
TagsFLAGExpressionMammalianMutationE153G and D871G mutations in WTS1 compared to Gen…PromoterCMVAvailable SinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
Sema6b(S)-Fc-His
Plasmid#72166PurposeExpresses the extracellular region of the Sema6B protein (truncated at extracellular domain cleavage site; ie, short), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema6d.4-Fc-His
Plasmid#72170PurposeExpresses the extracellular region of the Sema6D, isoform 4 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
BMR1_03g04550-bio-His
Plasmid#108026PurposeExpresses enzymatically monobiotinylated full-length BMR1_03g04550 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertBMR1_03g04550
TagsratCD4d3+4,biotinylation sequence, 6xHisExpressionMammalianMutationall potential N-linked glycosylation sites (N-X-S…PromoterCMVAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
BMR1_02g00615-bio-His
Plasmid#108029PurposeExpresses enzymatically monobiotinylated full-length BMR1_02g00615 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertBMR1_02g00615
TagsratCD4d3+4,biotinylation sequence, 6xHisExpressionMammalianMutationall potential N-linked glycosylation sites (N-X-S…PromoterCMVAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHTSHP-Smt-IIShhN
Plasmid#121135PurposeExpresses N-terminal SUMO tagged II-ShhN in bacteriaDepositorInsertShh (Shh Mouse)
TagsHIS, HRV3C site, MBP, and Smt tagExpressionBacterialMutationAmino acid sequence from 26-195, with two extra i…PromotertacAvailable SinceJan. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
CRY-GalVP16l (B694)
Plasmid#92030Purposeexpresses CRY2 (Full length, mutant NLS) fused to Gal4DNA (residues 1-147) fused to VP16 activation domain (long form)DepositorInsertCRY2 (CRY2 Mustard Weed)
TagsGalBD-VP16ExpressionMammalianMutationNLS sequence of CRY2 mutatedPromoterCMVAvailable SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
TLP-bio
Plasmid#47787PurposeExpresses enzymatically monobiotinylated full-length TLP ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised TLP
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_1431400-bio
Plasmid#47791PurposeExpresses enzymatically monobiotinylated full-length PF3D7_1431400 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised PF3D7_1431400
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-SNCAe3-WT
Plasmid#85847PurposeDonor plasmid for SNCA exon3 wild type sequence. lso contains TagBFP and dTomatoDepositorInsertSNCA exon 3 homology arms (SNCA Human)
ExpressionBacterial and MammalianAvailable SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BE3-2X
Plasmid#110835PurposeCMV expression vector for BE3-2X construct (not codon optimized)DepositorInsertBE3-2X
ExpressionMammalianMutation2 tandem NLS sequences in the XTEN linkerPromoterCMVAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BE3-FNLS
Plasmid#110836PurposeCMV expression vector for BE3-FNLS construct (not codon optimized)DepositorInsertBE3-FNLS
Tags3X FLAGExpressionMammalianMutationNLS sequence at the N-terminusPromoterCMVAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
Ntng2.a-AP-His
Plasmid#71994PurposeExpresses the extracellular region of the Netrin G2, isoform a protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3XFLAG-MKK7-EE-NLS hygro
Plasmid#87780PurposeInducible expression of constitutively active mutant MKK7 with a C-terminal NLS sequenceDepositorAvailable SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
RGS-6xHis-BLMP-1-pcDNA3.1-
Plasmid#52514Purposeexpresses C. elegans BLMP-1 in mammalian cells with RGS-6xHis tag at N-terminusDepositorInsertblmp-1 (blmp-1 Nematode)
Tags6xHisExpressionMammalianMutationN75S mutation compared GenBank reference sequence…PromoterCMVAvailable SinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.d-AP-His
Plasmid#71987PurposeExpresses the extracellular region of the Netrin G1, isoform d protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nrp2.3-Fc-His
Plasmid#72100PurposeExpresses the extracellular region of the Neuropilin 2, isoform 3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nrp2.4-Fc-His
Plasmid#72101PurposeExpresses the extracellular region of the Neuropilin 2, isoform 4 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Neo1.c-AP-His
Plasmid#71965PurposeExpresses the extracellular region of the Neogenin 1, isoform c protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only