We narrowed to 17,818 results for: multi
-
Plasmid#234579PurposeExpression of MBP-EZH2, MBP-SUZ12, MBP-EED and MBP-RBBP4DepositorAvailable SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pLenti-H3.3(K36M)-3AID-HA-2A-mTurquoiseBSD
Plasmid#225703PurposeLentiviral expression of AID degron tagged H3.3(K36M) and mTurquoise fused BlasticidinRDepositorUseLentiviral and Synthetic BiologyTags3xAID HA and T2A-mTurquoiseExpressionMammalianMutationK36MPromoterpEF1AAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-H3.3(K27M)-3AID-HA-2A-mTurquoiseBSD
Plasmid#225702PurposeLentiviral expression of AID degron tagged H3.3(K27M) and mTurquoise fused BlasticidinRDepositorUseLentiviral and Synthetic BiologyTags3xAID HA and T2A-mTurquoiseExpressionMammalianMutationK27MPromoterpEF1AAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-H3.3(K27M)-3AID-HA-2A-mCherryBSD
Plasmid#225698PurposeLentiviral expression of AID degron tagged H3.3(K27M) and mCherry fused BlasticidinRDepositorUseLentiviral and Synthetic BiologyTags3xAID HA and T2A-mCherryExpressionMammalianMutationK27MPromoterpEF1AAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
LPAR1-DuET
Plasmid#213329PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
AGTR1-DuET
Plasmid#213183PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
FLAG-D1-IRES-SS-D2-IRES-HA-D3
Plasmid#215119PurposeExpresses FLAG-Cyclin D1, SS-Cyclin D2 and HA-Cyclin D3 in mammalian cells from an inducible lentiviral vector.DepositorUseLentiviralTagsFLAG-tag, HA-tag, and SS (STREP-STREP)ExpressionMammalianPromoterIRES and TREG3Available SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG Kdm1a-exon minimal CMV pCDNA5
Plasmid#212054PurposeLR vector for integration of Kdm1a-exon into N2a FRT rtTA3 expression cellsDepositorInsertKdm1a-exon (Kdm1a Mouse)
ExpressionMammalianAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC-T7-J1~398-Luc
Plasmid#208639Purposefor in vitro transcription template preparation, insert T7 promoter, JFH1(AB047639)_1~398 and F-luc from pGL3-Basic, into pUC19DepositorInsertHepatitis C virus (HCV) strain JFH1(AB047639) nt 1~398
UseLuciferase; In vitro transcription templateTagsFirefly Luciferase (F-Luc and T7 promoterMutationnt 1~398, in frame with donstream F-LucPromoterT7Available SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
Dox-Akt
Plasmid#207328PurposePiggyBac vector backbone encoding doxycycline-inducible expression of membrane-localized Akt1 (without pleckstrin homology domain)DepositorInsertrac protein kinase-alpha (AKT1 Human)
Tagsmyristoylation tag - BFPExpressionBacterialMutationrange: 129 - 480PromoterTet Response ElementAvailable SinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMT1-24X-NOG(CmYLCV)
Plasmid#202014PurposeT-DNA vector for expression of the two protein components of the MoonTag system (dCas9-24XGP41 and NbGP41P-sfGFP-VP64-GB1) under the control of the CmYLCV promoter.DepositorInsertsdCas9-24XGP41
NbGP41P-sfGFP-VP64-GB1
TagsGB1 and sfGFPExpressionPlantPromoterCmYLCVAvailable SinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMOD_D-CmYLCV-NbGP41P-sfGFP-VP64-GB1
Plasmid#202010PurposeMoclo level 1 - Module D, Promoter: CmYLCV, Gene: NbGP41P-sfGFP-VP64-GB1, Terminator: ZmUBIDepositorInsertNbGP41P-sfGFP-VP64-GB1
UseSynthetic Biology; Moclo level 1 vectorTagsGB1 and sfGFPPromoterCmYLCVAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dSaCas9-KRAB-gRNA-TRE-blast
Plasmid#201151PurposeLentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsSadCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAMutationgRNA sequence: ATCAGTGATAGAGAACGTATGAvailable SinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-REPORT(EF1a no GFP) mnuctdTomato
Plasmid#172342PurposemnuctdTomatoDepositorInsertsmonomeric nuclear Tomato
HygR
UseLentiviral and Synthetic BiologyTagsSV40 NLSExpressionMammalianPromoterEF1alphaAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7m_tKiMBImut-T2A-AkaLuc-P2A-Blasticidin
Plasmid#199585PurposeExpress tKiMBImut(AA), AkaLuc and Blasticidin in a lentivirus vectorDepositorInsertsERK tdTomato-Kinase-Modulated Bioluminescent Indicator(mutant)
AkaLuc
Blasticidin
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceJune 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
Linked Free ClLIS1 (M)
Plasmid#182487PurposeYeast integrative plasmid for expressing fusion protein ERG20(F96W-N127W)-ClLIS1, with linker sequence AG4TGGA (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3)DepositorInsertFPPS(M)-LS
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTE1059
Plasmid#186628PurposeExpression of S. coelicolor butyrolactone biosynthesis genes in E. coli. Heterologous production of SCBs.DepositorInsertsscbA
scbB
scbC
UseSynthetic BiologyTags6xHis and 6xHis-thrombinExpressionBacterialPromoterSynthetic promoter B10, Synthetic promoter B19, a…Available SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBZ191-pU6-sgBFP-CBh-sv40NLS-Cas9-NLS-T2A-mCherry
Plasmid#170183PurposeExpression vector for a sgRNA against BFP and spCas9 linked to mCherry via a T2A peptideDepositorInsertsgBFP
ExpressionMammalianPromoterhU6Available SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPPC011
Plasmid#171143PurposeExpression of Sp.pCas9-dCas9 and BBa_J23107-MCP-SoxS(R93A/S101A) on pRK2-KmR plasmidDepositorInsertSp.pCas9-dCas9_BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPRExpressionBacterialMutationSoxS has R93A and S101A mutationsPromoterSp.pCas9, BBa_J23107Available SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only