We narrowed to 5,259 results for: crispr cas9 grna plasmid

#166108

This plasmid encodes a Cas9 protein as well as two sgRNAs, one targets the C-terminus of Cyr1 and the other targets a non-coding region on chromosome X (location X1)

Matthias Heinemann

April 13, 2021

Academic Institutions and Nonprofits only

#187599

Base editing plasmid, constitutively expressing cytosine base editor and cas6. Contains GFP, flanked by BsaI restriction sites to introduce spacer and gRNAs. Apramycin resistance

Pablo Ivan Nikel

Volke et al Nat Commun. 2022 May 31;13(1):3026. doi:

July 27, 2022

Academic Institutions and Nonprofits only

#184403

pX459 (sgRNA and Cas9 expressing plasmid, RRID:Addgene_62988) with targeting sequence specific to AAVS1; targeting sequence is: GGGGCCACTAGGGACAGGAT

Robert Bradley

Udy et al Life Sci Alliance. 2021 Dec 8;5(3). pii:

May 20, 2022

Academic Institutions and Nonprofits only

#192146

Expresses Nme2-sgRNA cloned with BspQI

Yongming Wang

Wei et al Elife. 2022 Aug 12;11. pii: 77825. doi:

April 24, 2023

Academic Institutions and Nonprofits only

#210388

All-in-one cumate-based inducible CRISPRi plasmid for use in Streptomyces

Gilles van Wezel

Bai et al ACS Synth Biol. 2023 Oct 6. doi: 10.1021

Jan. 22, 2024

Academic Institutions and Nonprofits only

#171031

CRISPR plasmids encodes Cas9 and a sgRNA targeting EZH2 exon 2 - intron 2 junction (sequence: GCAGACGAGCTGATGAAGTAA)

Thomas Cech

Long et al Nat Genet. 2020 Sep;52(9):931-938. doi:

Aug. 26, 2021

Academic Institutions and Nonprofits only

#131774

Guide RNA (gCASS5a) and Cas9 expression plasmid for cleaving pFA6 series deletion cassettes, including KanMX, hphMX and natMX. Used to perform CRISPR-Swap of alleles.

Frank Albert

Lutz et al PLoS Genet. 2019 Nov 18;15(11):e1008375.

Oct. 7, 2019

Academic Institutions and Nonprofits only

#210387

All-in-one cumate-based inducible CRISPRi plasmid for use in Streptomyces

Gilles van Wezel

Bai et al ACS Synth Biol. 2023 Oct 6. doi: 10.1021

Jan. 22, 2024

Academic Institutions and Nonprofits only

#155051

Lentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and LbCas12a nucleases (CHyMErA system)

Benjamin Blencowe, Jason Moffat

Gonatopoulos-Pournatzis et al Nat Biotechnol. 2020 May;38(5):638-648.

Aug. 12, 2020

Academic Institutions and Nonprofits only

#188963

L-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdown

Seung-Goo Lee

Kim et al Nucleic Acids Res. 2022 Dec 9;50(22):131

Sept. 13, 2022

Academic Institutions and Nonprofits only