We narrowed to 3,063 results for: ER
-
Plasmid#65212PurposeFull length mammalian expression vector for hESR2DepositorAvailable SinceJune 29, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pSG5-HA-ERR3 E275A,R316A
Plasmid#107768PurposeExpresses a modified receptor with inactivating mutations in key ligand binding residuesDepositorInsertEstrogen-related receptor gamma (Esrrg Mouse)
TagsHAExpressionMammalianMutationE275A,R316A double mutantPromoterSV40Available SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
mCerulean3-BclXL-Cb5-s2193
Plasmid#177413PurposeTo express mCerulean3 fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-XL-Cb5: Bcl-XL with its membrane binding region swapped for Cb5 (ER targeting sequence).DepositorInsertBcl-XL-Cb5, BclX-cb5
TagsmCerulean3ExpressionMammalianPromoterHuman ferritinAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Venus-BclXL-Cb5-pEGFP-C1
Plasmid#177415PurposeTo express Venus fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-XL-Cb5: Bcl-XL with its membrane binding region swapped for Cb5 (ER targeting sequence).DepositorInsertBcl-XL-Cb5, BclX-cb5
TagsVenusExpressionMammalianPromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-GCaMP5G
Plasmid#31788Purposea single-wavelength GCaMP3-based calcium indicator with improved response. Please also see the GCaMP6s/m/f indicators.DepositorInsertGCaMP5G
Tags6xHis, T7 epitope, and Xpress tagExpressionMammalianPromoterCMVAvailable SinceAug. 22, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON HaloTag-Jph3 WPRE
Plasmid#236238PurposeAAV expression of human Junctophilin3 N-terminally tagged with HaloTagDepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.iGluSnFR3.v857.SGZ
Plasmid#178330PurposeFluorescent reporter for glutamate, third generation, variant 857 in Stargazin (SGZ) backbone. iGluSnFR3.v857.SGZDepositorInsertpAAV hSyn iGluSnFR3 v857.SGZ
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and Stargazin and PDZ dom…ExpressionMammalianAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.iGluSnFR3.v857.GPI
Plasmid#178331PurposeFluorescent reporter for glutamate, third generation, variant 857 in GPI backbone. iGluSnFR3.v857.GPIDepositorHas ServiceAAV1InsertpAAV hSyn iGluSnFR3 v857.GPI
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsGPI Anchor, IgK-chain, and Myc epi tagExpressionMammalianAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.iGluSnFR3.v857.PDGFR
Plasmid#178329PurposeFluorescent reporter for glutamate, third generation, variant 857. iGluSnFR3.v857DepositorHas ServiceAAV1InsertpAAV hSyn iGluSnFR3 v857.PDGFR
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and PDGFR TM DomainExpressionMammalianAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.iGluSnFR3.v857.GPI.codonopt
Plasmid#175181PurposeFluorescent reporter for glutamate, third generation, variant 857 in GPI backbone. iGluSnFR3.v857.GPIDepositorHas ServiceAAV1InsertpAAV hSyn FLEX iGluSnFR3 v857.GPI
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsGPI Anchor, IgK-chain, and Myc epi tagExpressionMammalianPromoterhuman SynapsinAvailable SinceOct. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mCherry-Jph3 WPRE
Plasmid#236237PurposeAAV expression of human Junctophilin3 N-terminally tagged with mCherryDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.iGluSnFR3.v82.GPI.codonopt
Plasmid#175184PurposeFluorescent reporter for glutamate, third generation, variant 82 in GPI backbone. iGluSnFR3.v82.GPIDepositorInsertpAAV hSyn FLEX iGluSnFR3 v82.GPI
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsGPI Anchor, IgK-chain, and Myc epi tagExpressionMammalianPromoterhuman SynapsinAvailable SinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-CAG-FLEX-jGCaMP7s-WPRE
Plasmid#104495PurposeAAV-mediated expression of ultrasensitive protein calcium sensor under the CAG promoter, Cre mediated flip-excision switchDepositorHas ServiceAAV PHP.eB, AAV Retrograde, and AAV1InsertjGCaMP7s
UseAAV and Cre/LoxTagsT7 epitope, Xpress tag, 6xHisExpressionMammalianPromoterCAGAvailable SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.iGluSnFR3.v857.IgK-NGR
Plasmid#196227PurposeFluorescent reporter for glutamate, third generation, variant 857 in NGR backbone. iGluSnFR3.v857.NGRDepositorInsertpAAV hSyn iGluSnFR3 v857.NGR
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and NGR TM DomainExpressionMammalianAvailable SinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-BPNLS-ABE8e(V106W)-SpRY-BPNLS-P2A-EGFP (CA136)
Plasmid#208291PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e(V106W) A-to-G base editor with SpRY(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e(V106W)-SpRY-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations and V106W in TadA and nSpRY(D10A/…PromoterCMV and T7Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.FLEX.iGluSnFR3.v857.GPI
Plasmid#196218PurposeFluorescent reporter for glutamate, third generation, variant 857 in GPI backbone. iGluSnFR3.v857.GPIDepositorInsertpAAV CAG.FLEX iGluSnFR3 v857.GPI
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsGPI Anchor, IgK-chain, and Myc epi tagExpressionMammalianPromoterCAGAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.iGluSnFR3.v857.SGZ
Plasmid#178337PurposeFluorescent reporter for glutamate, third generation, variant 857 in Stargazin (SGZ) backbone. iGluSnFR3.v857.SGZDepositorInsertpAAV GFAP iGluSnFR3 v857.SGZ
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and Stargazin and PDZ dom…ExpressionMammalianAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.FLEX.iGluSnFR3.v857.PDGFR
Plasmid#196219PurposeFluorescent reporter for glutamate, third generation, variant 857 in PDGFR backbone. iGluSnFR3.v857.PDGFRDepositorHas ServiceAAV2InsertpAAV CAG FLEX iGluSnFR3 v857.PDGFR
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and PDGFR TM DomainExpressionMammalianAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8.20m-SpCas9-NRTH-P2A-EGFP (RMD63)
Plasmid#197500PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE(8.20) A-to-G base editor with nSpCas9-NRTH(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8.20m-nSpCas9-NRTH-BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.20 mutations in TadA and nSpCas9-NRTH(D10A/I…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pN1 Lck-GCaMP5G
Plasmid#34924PurposeExpresses a fusion between the Lck domain and cytosolic GCaMP5G. This construct targets GCaMP5G to the plasma membraneDepositorInsertLck-GCaMP5G
ExpressionMammalianMutationPlasmid contains N-terminal 26 amino acid membran…PromoterCMVAvailable SinceFeb. 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLP-FRT.iGluSnFR3.v857.GPI
Plasmid#196223PurposeFluorescent reporter for glutamate, third generation, variant 857 in GPI backbone. iGluSnFR3.v857.GPIDepositorInsertpAAV hSyn FLP-FRT iGluSnFR3 v857.GPI
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsGPI anchor, IgK-chain, and Myc epi tagExpressionMammalianAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLP-FRT.iGluSnFR3.v857.SGZ
Plasmid#196224PurposeFluorescent reporter for glutamate, third generation, variant 857 in SGZ backbone. iGluSnFR3.v857.SGZDepositorInsertpAAV hSyn FLP-FRT iGluSnFR3 v857.SGZ
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and Stargazin and PDZ dom…ExpressionMammalianAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.iGluSnFR3.v857.PDGFR.codonopt
Plasmid#175180PurposeFluorescent reporter for glutamate, third generation, variant 857. iGluSnFR3.v857DepositorHas ServiceAAV1InsertpAAV hSyn FLEX iGluSnFR3 v857.PDGFR
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and PDGFR TM DomainExpressionMammalianPromoterhuman SynapsinAvailable SinceSept. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.iGluSnFR3.v857.SGZ
Plasmid#178334PurposeFluorescent reporter for glutamate, third generation, variant 857 in Stargazin (SGZ) backbone. iGluSnFR3.v857.SGZDepositorInsertpAAV CAG iGluSnFR3 v857.SGZ
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and Stargazin and PDZ dom…ExpressionMammalianAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.iGluSnFR3.v857.SGZ.codonopt
Plasmid#175182PurposeFluorescent reporter for glutamate, third generation, variant 857 in Stargazin (SGZ) backbone. iGluSnFR3.v857.SGZDepositorInsertpAAV hSyn FLEX iGluSnFR3 v857.SGZ
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and Stargazin and PDZ dom…ExpressionMammalianPromoterhuman SynapsinAvailable SinceSept. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-sgKRAS hUbC-dCas9-KRAB-T2a-GFP1
Plasmid#184556PurposeKnockdown of murine KRAS gene by targeting the promoter region via CRISPRi systemDepositorInsertKirsten rat sarcoma virus (Kras Mouse)
UseCRISPR, Lentiviral, and Mouse TargetingTagsFlagExpressionBacterialAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP7c variant 1513-WPRE
Plasmid#105322PurposeAAV-mediated expression of ultrasensitive protein calcium sensor under the Syn promoter, Cre-dependent expressionDepositorHas ServiceAAV1InsertjGCaMP7c variant 1513
UseAAV and Cre/LoxTagsT7 epitope, Xpress tag, 6xHisExpressionMammalianPromoterSynapsinAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-BPNLS-CE-ABE8e-SpRY--BPNLS-P2A-EGFP (NK289)
Plasmid#208293PurposeCMV and T7 promoter expression plasmid for human codon optimized CE-ABE8e-SpRY A-to-G base editor and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-CE-ABE8e-SpRY-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA inlaid into nSpRY(D10A/A6…PromoterCMV and T7Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.iGluSnFR3.v857.IgK-NGR
Plasmid#196226PurposeFluorescent reporter for glutamate, third generation, variant 857 in NGR backbone. iGluSnFR3.v857.NGRDepositorInsertpAAV hSyn FLEX iGluSnFR3 v857.NGR
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and NGR TM DomainExpressionMammalianAvailable SinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
U6-PGK-hCD2
Plasmid#224294PurposeExpresses sgRNA from U6 promoter and human CD2 under PGKDepositorInsertU6 sgRNA cassette with CD2 under PGK promoter (CD2 Human)
UseCRISPR and RetroviralExpressionMammalianPromoterU6/PGKAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMWCAVI_H6BAP-OROV_N
Plasmid#240162PurposePlasmid encoding Oropouche virus (OROV) nucleoprotein (N) with an N-terminal His6 and biotin acceptor peptide (BAP, a.k.a. AviTag) for expression in E. coliDepositorInsertNucleoprotein
Tags6xHis, Biotin acceptor peptide (BAP, a.k.a. AviTa…ExpressionBacterialAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOPTH OROV N
Plasmid#229663PurposeExpress Oropouche virus BeAn 19991 nucleoprotein with N-terminal His6 tagDepositorInsertNucleoprotein
Tags6xHisExpressionBacterialPromoterT7Available SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mScarlet-STIM2 WPRE
Plasmid#236236PurposeAAV expression of human STIM2 internally tagged with mScarlet-IDepositorInsertmScarletI-STIM2 (STIM2 Human)
UseAAVTagsmScarletI in position 29MutationSignal peptide from STIM1 and residues 15-746 of …Promoterhuman Synapsin 1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON HaloTag-STIM2 WPRE
Plasmid#236235PurposeAAV expression of human STIM2 internally tagged with HaloTagDepositorInsertHaloTag-STIM2 (STIM2 Human)
UseAAVTagsHaloTag in position 29MutationSignal peptide from STIM1 and residues 15-746 of …Promoterhuman Synapsin 1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-sgKRAS hUbC-dCas9-KRAB-T2a-GFP2
Plasmid#184557PurposeKnockdown of murine KRAS gene by targeting the promoter region via CRISPRi systemDepositorInsertKirsten rat sarcoma virus (Kras Mouse)
UseCRISPR, Lentiviral, and Mouse TargetingTagsFlagExpressionBacterialAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCherry-PTDSS1-IRES-puromycin-pLVx-EF1a
Plasmid#177435PurposeTo express mCherry fused to PTDSS1, a protein that localized to mitochondria associated ER membranes (MAMs). Lentiviral vector used to make cell lines expressing this MAM landmark.DepositorInsertPhosphatidylserine synthase-1, PTDSS1, LMHD, PSS1, PSSA (PTDSS1 Human)
UseLentiviralTagsmCherryExpressionMammalianPromoterEF1aAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCerulean3-BclXL-Cb5-pEGFP-C1
Plasmid#177414PurposeTo express mCerulean3 fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-XL-Cb5: Bcl-XL with its membrane binding region swapped for Cb5 (ER targeting sequence).DepositorInsertBcl-XL-Cb5, BclX-cb5
TagsmCerulean3ExpressionMammalianPromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Venus-Bcl2-cb5-pEGFP-C1
Plasmid#177422PurposeTo express Venus fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-2-Cb5: Bcl-2 with its membrane binding region swapped for Cb5 (ER targeting sequence).DepositorInsertBcl-2-Cb5, Bcl2-cb5, Bcl-cb5
TagsVenusExpressionMammalianPromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCerulean3-Bcl2-cb5-s2193
Plasmid#177423PurposeTo express mCerulean3 fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-2-Cb5: Bcl-2 with its membrane binding region swapped for Cb5 (ER targeting sequence).DepositorInsertBcl-2-Cb5, Bcl2-cb5, Bcl-cb5
TagsmCerulean3ExpressionMammalianPromoterHuman ferritinAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pESR1.1.0-gDNA
Plasmid#112433PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ESR1DepositorAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pESR1-donor
Plasmid#112337PurposeCRISPR donor plasmid to tag human transcription factor ESR1 with GFPDepositorAvailable SinceApril 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-HDEL
Plasmid#129098PurposeFor labeling endoplasmic reticulum (ER) in S. cerevisiae with GFP-HDELDepositorInsertTEF1p-SS-3xGlyAla-GFP-HDEL
ExpressionYeastAvailable SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn 2xLyn-ERex-mKate2-bPAC(F198Y)
Plasmid#219654PurposeNeuronal expression of PACmn with mKate2, a membrane targeted version of the photoactivatable adenylyl cyclase from Beggiatoa with lowered dark activity.DepositorInsert2xLyn-ERex-mKate2-bPAC(F198Y)
UseAAVTagsER exit ( FCYENE) and Lyn11 (GCIKSKGKDS)ExpressionMammalianPromoterSynAvailable SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
mCherry-7aa-cb5-pEGFP-C1
Plasmid#177407PurposeTo express mCherry fused to endoplasmic reticulum (ER) targeting sequence "Cb5". mCherry faces the cytosol.DepositorAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCerulean3-Bcl2-cb5-pEGFP-C1
Plasmid#177421PurposeExpress mCerulean3 fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-2-Cb5: Bcl-2 with its membrane binding region swapped for Cb5 (ER targeting sequence).DepositorInsertBcl-2-Cb5, Bcl2-cb5, Bcl-cb5
TagsmCerulean3ExpressionMammalianPromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGP-pcDNA3.1 Puro-CAG-Voltron2
Plasmid#172909PurposeMammalian expression of voltage sensorDepositorInsertVoltron2
ExpressionMammalianMutationA122DPromoterCAGAvailable SinceNov. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQ-Elo-HB-C-A(1-772)
Plasmid#171085PurposeCo-expresses of WT-ELOA containing Elongin complex in bacteria. The resulting plasmid was used to generate a single expression construct encoding all 3Elongin subunits, with a 6-His tag on ELOBDepositorTagsHisExpressionBacterialMutationDeleted N-term 26 amino acids for expression purp…PromoterT5 promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only