We narrowed to 10,841 results for: esp
-
Plasmid#244089PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsIgG kappa leader and mRuby3Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-mScarlet-Frame1-Parental-Minicircle
Plasmid#216125PurposeParental minicircle containing mScarlet-I flanked by a splice acceptor and splice donor. Used with other intron tagging plasmids for placing the mScarlet tag as a synthetic exon into frame 1 introns of target genes.DepositorInsertsgRNA-SA-(GGGGS)x4-mScarlet-I-(GGGGS)x4-SD
UseCRISPRAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Cepheid1b-ST-WPRE
Plasmid#214967PurposeRed fluorescent, negative response-polarity voltage indicator under the control of synapsin promoter; soma-targeted; for brighter fluorescenceDepositorInsertCepheid1b-ST
UseAAVPromoterhuman SynapsinAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lox-stop-Lox p53 R270H
Plasmid#14853DepositorInsertp53 R270H (Trp53 Mouse)
UseCre/LoxTagsLox-STOP-loxExpressionMammalianMutationContact mutant R270H. (Murine p53 codon 270 corre…Available SinceApril 27, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UBC-ERT2-iCre-ERT2
Plasmid#178060PurposeConditionally active form of Cre recombinase (activated in response to tamoxifen) under UBC promoter.DepositorInsertERT2-iCre-ERT2
UseAAVExpressionMammalianPromoterHuman ubiquitin C (UBC) promoterAvailable SinceOct. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNTI647 dCas9-Mxi1 TetR KanMX
Plasmid#139474PurposeIntegrates CRISPRi effector and tet-responsive regulatorDepositorInsertsdCas9-Mxi1
Tet Repressor
UseCRISPRTagsMxi1 and NLSExpressionYeastMutationD10A, H840APromoterpGPM1 and pTEF1Available SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Cepheid1s-ST-WPRE
Plasmid#214968PurposeRed fluorescent, negative response-polarity voltage indicator under the control of synapsin promoter; soma-targeted; for better photostabilityDepositorInsertCepheid1s-ST
UseAAVPromoterhuman SynapsinAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-CMV-GRAB_LoX3-mut
Plasmid#234651PurposeThis plasmid encodes a mutated version of the genetically encoded chemokine biosensor LoX3-1.0, which is designed to be non-responsive to chemokine binding.DepositorInsertGPCR activation-based mutant chemokine CXCL9-11 sensor GRAB_LoX3-mut
ExpressionMammalianPromoterCMVAvailable SinceAug. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapFLEX.(mem).iGlucoSnFR2.mIRFP670nano3
Plasmid#244102PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mIRFPDepositorInsertiGlucoSnFR2.mIRFP670nano3
UseAAVTagsIgG kappa leader and mIRFP670nano3Available SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pANAP-P2A-eRF(E55D)
Plasmid#241290PurposeAllows co-translational incorporation of the fluorescent ncAA Anap directly into the target protein; expresses tRNACUA-Leu, AnapRS, and dominant negative ribosomal release factorDepositorInsertthe amber suppressor tRNACUA-Leu
ExpressionMammalianMutationmutant E.coli leucyl synthetase specific for Anap…PromoterCMVAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-pAceR-Kv2.1PR
Plasmid#195534PurposeCre-dependent red fluorescent, positive response-polarity voltage indicator; soma-targetedDepositorInsertpAceR-Kv2.1 proximal restriction sequence
UseAAV and Cre/LoxExpressionMammalianMutationVARNAM 78E, 81D, 92N; SI linkerPromoterCAGAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTN4
Plasmid#174212PurposeDonor plasmid for introducing Peft-3::AtTIR1(F79G)::mRuby at the ttTi5605 locusDepositorAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(cyto).iGlucoSnFR2.HaloTag
Plasmid#244094PurposeCytosolic expression of green glucose sensor with non-responsive HaloTagDepositorInsertiGlucoSnFR2.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(cyto).iGlucoSnFR2.H348H.HaloTag
Plasmid#244095PurposeCytosolic expression of green glucose sensor (high affinity) with non-responsive HaloTagDepositorInsertiGlucoSnFR2.H348H.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
Dox-Akt
Plasmid#207328PurposePiggyBac vector backbone encoding doxycycline-inducible expression of membrane-localized Akt1 (without pleckstrin homology domain)DepositorInsertrac protein kinase-alpha (AKT1 Human)
Tagsmyristoylation tag - BFPExpressionBacterialMutationrange: 129 - 480PromoterTet Response ElementAvailable SinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-EGFP-Frame0-Parental-Minicircle
Plasmid#216124PurposeParental minicircle containing EGFP flanked by a splice acceptor and splice donor. Used with other intron tagging plasmids for placing the EGFP tag as a synthetic exon into frame 0 introns of target genes.DepositorInsertsgRNA-SA-(GGGGS)x4-EGFP-(GGGGS)x4-SD
UseCRISPRAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.(mem).iGlucoSnFR2.mRuby3
Plasmid#244075PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsIgG kappa leader and mRuby3Available SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eCas9-T2A-EGFP-U6-gRNA-no ITR and f1 ori
Plasmid#234724PurposeAll-in-one CRISPR/Cas9 vector with high-fidelity eSpCas9 expression in neurons. The plasmid lacks AAV2 ITR and f1 ori elements, enabling more efficient transfection and expression.DepositorTypeEmpty backboneUseCRISPRTagsT2A-GFPExpressionMammalianPromoterCAG promoterAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
Bxb1-GT_hEF1a-mGL_CAG-mRuby2_Divergent
Plasmid#229800PurposeBxb1-GT donor plasmid with divergent syntax for constitutively expressing mRuby2 and mGreenLantern by the respective promoters CAG and hEF1aDepositorInsertmGreenLantern; mRuby2
UseSynthetic BiologyExpressionMammalianPromoterhEF1a and CAGAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only