We narrowed to 16,217 results for: GRN
-
Plasmid#235244PurposeEncodes gRNA for human ITGB6DepositorAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Nat-ADE2
Plasmid#232106PurposeExpresses estradiol-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 toā¦PromoterZ3Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Hyg-ADE2
Plasmid#232104PurposeExpresses galactose-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 toā¦PromoterGAL7Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Hyg-ADE2
Plasmid#232107PurposeExpresses estradiol-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 toā¦PromoterZ3Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro SPNS1_sg2
Plasmid#218531PurposesgRNA targeting human SPNS1DepositorInsertSPNS1 (SPNS1 Human)
UseCRISPR and LentiviralAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro SPNS1_sg1
Plasmid#218530PurposesgRNA targeting human SPNS1DepositorInsertSPNS1 (SPNS1 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgVRK2-puro
Plasmid#199636PurposesgRNA guide against VRK2DepositorInsertN/A (VRK2 Human)
UseLentiviralAvailable SinceAug. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgLacZ-puro
Plasmid#199635PurposesgRNA control guide targeting bacterial LacZDepositorInsertN/A
UseLentiviralAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgCTRL-puro
Plasmid#199634PurposesgRNA control guide targeting intergenic regionDepositorInsertN/A
UseLentiviralAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mNudcd3 - 1
Plasmid#198501Purposelentiviral stable expression of mNudcd3 gRNA 1DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mNudcd3 - 2
Plasmid#198502Purposelentiviral stable expression of mNudcd3 gRNA 2DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mRab12-2
Plasmid#198476Purposelentiviral stable expression of mRab12 gRNA 2DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mRab12-1
Plasmid#198475Purposelentiviral stable expression of mRab12 gRNA 1DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Bla-dCas9-KRAB-MeCP2_hU6-A10
Plasmid#196081PurposeInducible CRISPRi vector conferring blasticidin S resistance, expressing gRNA targeting mouse Adam10.DepositorInsertgRNA targeting Adam10
UseCRISPRExpressionMammalianMutationCloned using SapI sites - destroyed after insertiā¦Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Hyg-dCas9-KRAB-MeCP2_hU6-A10
Plasmid#196083PurposeInducible CRISPRi vector conferring hygromycin B resistance, expressing gRNA targeting mouse Adam10.DepositorInsertgRNA targeting Adam10
UseCRISPRExpressionMammalianMutationCloned using SapI sites - destroyed after insertiā¦Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only