We narrowed to 1,583 results for: CAG promoter
-
Plasmid#70661PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an AAVS1-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorInsertsgRNA against AAVS1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shTRAF2#1
Plasmid#44127DepositorInsertTRAF2 (TRAF2 Human)
UseLentiviral and RNAiAvailable SinceMarch 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shTRAF2#2
Plasmid#44128DepositorInsertTRAF2 (TRAF2 Human)
UseLentiviral and RNAiAvailable SinceMarch 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
CMV-TO-g0 (FLP-IN)
Plasmid#236120PurposePlasmid encoding g0 guide RNA under control of CMV promoter with two TetR binding sites, used to equalize plasmid masses for transfectionDepositorInsertg0
ExpressionMammalianPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBT009.119.DA9
Plasmid#206803PurposeExpresses DA9 scRNA for activation of pDA303DepositorInsertDA9 scRNA
PromoterJ23119Available SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pB-puro-mU6-RtcAshRNA1
Plasmid#126613PurposeExpresses shRNA against human RtcA under mouse U6 promoterDepositorInsertRtcA shRNA-1
UseRNAiPromotermouse U6 promoterAvailable SinceJune 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pB-puro-mU6-RtcAshRNA2
Plasmid#126614PurposeExpresses shRNA against human RtcA under mouse U6 promoterDepositorInsertRtcA shRNA-2
UseRNAiPromoterMouse U6 promoterAvailable SinceJune 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7 Alk.2 shRNA
Plasmid#59297PurposeshRNA to mouse AlkDepositorInsertAlk.2 shRNA
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromotermouse U6Available SinceAug. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EP400
Plasmid#226449PurposeFor subcloning of human EP400 promoter or for assays using M13 phageDepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
Gg 3kb Green opsin GFP
Plasmid#72919Purposegreen opsin promoter from chicken (Gallus gallus) gDNA chr26:4,504,913ā4,501,931 in galGal4 driving GFPDepositorInsertchicken green opsin promoter
Available SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSuper-Rem2-2
Plasmid#51595PurposeshRNA 2 against rodent Rem2DepositorAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
hIRF-1 gRNA #351 (Sa)
Plasmid#105283PurposeExpresses a guide RNA (gRNA) to target human IRF-1 promoter for the Sa-Cas9 systemDepositorInsertgRNA_hIRF1 promoter #351
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
hIRF-1 gRNA #409 (Sa)
Plasmid#98134PurposeExpresses a guide RNA (gRNA) to target human IRF-1 promoter for the Sa-Cas9 systemDepositorInsertgRNA_hIRF1 promoter #409
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
Gg 3kb Green opsin DsRed
Plasmid#72918Purposegreen opsin promoter from chicken (Gallus gallus) gDNA chr26:4,504,913ā4,501,931 in galGal4 driving DsRedDepositorInsertchicken green opsin promoter
Available SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA-puro
Plasmid#180426PurposeExpresses puromycin resistance gene and scrambled gRNA for stable integration in mammalian cells; useful as control and template for new gRNAs by mutagenesis.DepositorInsertgRNAscr
UseCRISPR and LentiviralExpressionMammalianPromoterhuman U6Available SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
LRG/Foxa1 e2.4
Plasmid#105511PurposeLentiviral expression of Foxa1 DNA-binding domain (exon 2) targeting sgRNADepositorInsertFoxa1 (sgRNA, e2.4)
UseLentiviralAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCELF4-4405
Plasmid#115466PurposeConstitutive lentiviral expressionDepositorAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
LRG/Rosa26
Plasmid#105510PurposeLentiviral expression of Rosa26 targeting sgRNADepositorInsertRosa26 (Gt(ROSA)26Sor Mouse)
UseLentiviralAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shMBNL3-9465
Plasmid#115464PurposeConstitutive lentiviral expressionDepositorAvailable SinceOct. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, Iā¦PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23ā¦Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only