We narrowed to 3,178 results for: val
-
Plasmid#221349PurposeMammalian expression of Anti-Biotin [IPI-M33] Mouse/Rabbit HC; to be used with Anti-Biotin [IPI-M33] light chain (Plasmid 221350) to make the antibody.DepositorInsertAnti-Biotin [IPI-M33] Mouse/Rabbit HC
UseAffinity Reagent/ AntibodyExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHTN-HaloTag_DDB1:1-1140
Plasmid#211006PurposeMammalian expression of full-length human DDB1. N-terminal HaloTag.DepositorAvailable SinceFeb. 21, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCMV-SARS2SΔC-H2gp41
Plasmid#170389PurposeGeneration of SARS-CoV-2 spike pseudotyped lentivirusDepositorInsertSARS-CoV-2 Spike (S SARS-CoV-2)
TagsHIV gp41ExpressionMammalianMutationDeletion of C terminal and fusion with H2 from HI…PromoterCMVAvailable SinceJune 23, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.2/V5 hsa-mir-455
Plasmid#26319DepositorInserthsa-mir-455 (MIR455 Human)
ExpressionMammalianAvailable SinceSept. 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
pTipi2.1_Anti-Biotin [IPI-M33] Mouse/Rabbit LC kappa
Plasmid#221350PurposeMammalian expression of Anti-Biotin [IPI-M33] Mouse/Rabbit LC kappa; to be used with Anti-Biotin [IPI-M33] heavy chain (Plasmid 221349) to make the antibody.DepositorInsertAnti-Biotin [IPI-M33] Mouse/Rabbit LC kappa
UseAffinity Reagent/ AntibodyExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTripZ EV
Plasmid#209071PurposeDOX-ON inducible expression vector that has a stuffer sequence after an LR reaction and used as empty expression vector controlDepositorInsertstuffer DNA sequence after LR recombination with pTripZ NEO DEST to be used as an empty vector control
UseLentiviralTags3XFLAGExpressionMammalianPromoterCMVAvailable SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD deltahexa
Plasmid#169714PurposeBacterial Expression of human hnRNPA1-A Low complexity domain including amino acids 186-320, hexapeptide including aa 259-264 deletedDepositorInserthnRNPA1 (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationhnRNPA1-A Low complexity domain including amino a…PromoterT7Available SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBiT3.1-N_FBXW7:1-707
Plasmid#211099PurposeMammalian expression of full-length human FBXW7. N-terminal HiBiT tag.DepositorInsertFBXW7:M1-K707 (FBXW7 Human)
TagsMVSGWRLFKKISGSSGGSSGExpressionMammalianMutationwild typePromoterCMVAvailable SinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR P2R-P3-EGFP
Plasmid#48349PurposeContributes the coding sequence for EGFP as the 3’-module during MultiSite Gateway-cloning of chimeric cDNAs encoding three-part fusion proteins.DepositorInsertEGFP
UseGateway CloningMutationAminoacid 40 is valine in our sequence, while it …PromoternoneAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
HA-CK2alpha’ V67A/I175A (pJD24)
Plasmid#37363DepositorInsertCK2α' V67A/I175A (CSNK2A2 Human)
TagsHAExpressionMammalianMutationV67A, I175APromoterCMVAvailable SinceJuly 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEABR NA 3C FLAG SA
Plasmid#234987PurposeFor production of Extracellular Vesicles (EVs), with the transmembrane region of Neuraminidase protein fused to Streptavidin on the vesicles surfaceDepositorInsertEABR-NA
TagsHRV 3C site, FLAG, Strep-Tactin (SA)ExpressionMammalianMutationIn the Streptavidin coding sequence Glu44Val/Ser4…Available SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5/to IRES-ECFP
Plasmid#126877Purposeexpresssion of tet inducible proteins with IRES-ECFPDepositorTypeEmpty backboneTagsIRES-ECFPExpressionMammalianPromoterCMVAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR P4-P1R-EGFP
Plasmid#48348PurposeContributes the coding sequence for EGFP as the 5’-module during MultiSite Gateway-cloning of chimeric cDNAs encoding three-part fusion proteins.DepositorInsertEGFP
UseGateway CloningMutationContains a Kozak sequence. Does not contain a sto…PromoternoneAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 14 mut B-Myb
Plasmid#25967DepositorInsertB-Myb (Mybl2 Mouse)
TagsFlagExpressionBacterialMutationChanged threonines 267, 408, 443, 447 490, 497, 5…Available SinceSept. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
pJKW0957
Plasmid#119026PurposeE.coli expression plasmid for PmKOMT1DepositorInsertPmKOMT1
Tags8xHisExpressionBacterialPromoterT7Available SinceJune 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFUS_A1A
Plasmid#43848DepositorInsertLacZ + BsaI restriction sites
Available SinceMarch 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFUS_A3A
Plasmid#43851DepositorInsertLacZ + BsaI restriction sites
Available SinceMarch 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIVEX-anchor
Plasmid#46844PurposeTemplate for the amplification of spiking anchors in BeSDDepositorTypeEmpty backboneUseIn vitro expressionAvailable SinceAug. 13, 2013AvailabilityAcademic Institutions and Nonprofits only