We narrowed to 11,393 results for: ENA
-
Plasmid#210708PurposeThis Plasmid express hSyn promoter driven SpdCas9DepositorInsertS. Pyogenes dCas9
UseAAV and CRISPRTagsFLAGExpressionMammalianMutationD10A/H840APromoterhSynAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcs2-HRI-GFP-IRES-mCherry
Plasmid#226099PurposeHRI stability reporter construct for transient expression in mammalian cellsDepositorAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
MAC_N_AURKB
Plasmid#111682PurposeMAC-tagged gene expressionDepositorInsertAURKB (AURKB Human)
ExpressionMammalianAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hChR2(C128S/D156A)-EYFP
Plasmid#35501PurposeAAV expression of CaMKII-driven stabilized step function opsin (SSFO) for optogenetic activation.DepositorInserthChR2
UseAAVTagsEYFPExpressionMammalianMutationC128S and D156APromoterCaMKIIaAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Neo-EF1A>Tet3G
Plasmid#184379PurposeThe Tet3G gene is expressed under a constitutive EF1-alpha promoter. This protein binds a TRE3G promoter to activate gene transcription only in the presence of tetracycline or its analogs (e.g. doxycycline)DepositorInsertTet3G
UseLentiviralAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOPINK-Cezanne2 (OTU+UBA, aa 1-462)
Plasmid#61582PurposeExpresses human Cezanne2 (OTU+UBA domains) in E. coli.DepositorInsertCezanne2 (OTUD7A Human)
TagsHis6-GST-3CExpressionBacterialMutationIsoform 2. Deleted aa 463-933.PromoterT7Available SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
FUW-TetO-Esrrb
Plasmid#40798DepositorAvailable SinceOct. 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCDNA-3xFLAG-NLS-TPP1
Plasmid#53585PurposeMammalian expression of 3xFLAG tagged, nuclear localized TPP1, N-terminal.DepositorInsertTPP1 (ACD Human)
Tags3xFLAG and NLSExpressionMammalianMutationSilent mutation to eliminate PacI sitePromoterCMVAvailable SinceJune 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2200
Plasmid#91082PurposeModule C, Promoter: none – to be combined with gRNA array in module B, Gene: SapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers (only works with pMOD_B2203), Terminator: 35SDepositorInsertSapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers
UseCRISPRPromoternone (will be fused to gRNA array in MODULE B)Available SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only