We narrowed to 14,250 results for: cas9 genes
-
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG13 sgRNA
Plasmid#207558PurposepX330 expressing Cas9 and a sgRNA targeting the ATG13 locusDepositorInsertggaaactgatctcaattccc
ExpressionMammalianPromoterCMV and U6Available SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro-sgRPL3-62
Plasmid#208647PurposepcDNA3.1 based plasmid for transient transfection of sgRNA-cas9. Containing sgRNA targeting human RPL3 (GRCh38.p14_Chr22:39312968-39312987), 62 is a number given by www.e-crisp.org.DepositorInsertsgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.62 (RPL3 Human, Synthetic)
UseCRISPRExpressionMammalianPromoterCMV and U6 in tandemAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro-sgRPL3-56
Plasmid#208979PurposepcDNA3.1 based plasmid for transient transfection of sgRNA-cas9. Containing sgRNA targeting human RPL3 (GRCh38.p14_Chr22:39312868-39312887), 56 is a number given by www.e-crisp.org.DepositorInsertsgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.56 (RPL3 Human, Synthetic)
UseCRISPRExpressionMammalianPromoterCMV and U6 in tandemAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCZGY2748
Plasmid#193331PurposeSite specific CRISPR/Cas9 editing of C. elegans Chr IDepositorInsertsgRNA for ttTi4348
TagsNoneExpressionWormPromoterU6Available SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
Ssh1 gRNA#2
Plasmid#163395PurposeCas9-mediated knockout of Ssh1 in mammalian cellsDepositorAvailable SinceAug. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Ssh1 gRNA#1
Plasmid#163394PurposeCas9-mediated knockout of Ssh1 in mammalian cellsDepositorAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
Ssh1 gRNA#3
Plasmid#163396PurposeCas9-mediated knockout of Ssh1 in mammalian cellsDepositorAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTJV1ScGm-rpoB
Plasmid#166979PurposeGenerates ssDNA in vivo targeting E. coli rpoB for recombineering w/ Beta recombinase; temp. sensitive pSC101 ori and sgRNA for Cas9 counterselection; aacC1 for gentamycin resistanceDepositorInsertgentamycin-3-acetyltransferase (aac(3)-Ia )
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmKaxxte
Plasmid#113630Purposeto test Cas9 gRNA efficiency or HR-capacityDepositorInsertmKaxxte2.5
ExpressionMammalianPromoterCMVAvailable SinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMAZ.1.0-gDNA
Plasmid#112455PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor MAZDepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTHRB.1.0-gDNA
Plasmid#112429PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor THRBDepositorAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE8.8m-WT-P2A-EGFP (BKS953)
Plasmid#242651PurposeCMV promoter expression plasmid for human codon optimized ABE8.8m A-to-G base editor with SpCas9(D10A) and P2A-EGFPDepositorInsertpCMV-ABE8.8m-SpCas9-P2A-EGFP
UseCRISPRExpressionMammalianMutationABE8.8 mutations in TadAPromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRhaB-8xHis-ABE8e-eVRQR (LLH551)
Plasmid#242658PurposepRhaB promoter expression plasmid for ABE8e-eVRQR with an N-terminal His8-tagDepositorInsertpRhaB-8xHis-BPNLS-TadA8e-SpCas9(D10A)-eVRQR-BPNLS
UseCRISPRTags8x-HisExpressionBacterialMutationeVRQR mutations in SpCas9(S55R/D1135V/G1218R/R133…PromoterRhaBAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-eVRQR-P2A-EGFP (KAC1028)
Plasmid#242663PurposeCMV promoter expression plasmid for human codon optimized SpCas9-eVRQR(S55R)-BPNLS(SV40)-3xFLAG-P2A-EGFPDepositorInsertpCMV-SpCas9-eVRQR(S55R)-BPNLS(SV40)-3xFLAG-P2A-EGFP
UseCRISPRTagsBPNLSExpressionMammalianMutationeVRQR mutations in SpCas9(S55R/D1135V/G1218R/R133…PromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only