We narrowed to 13,645 results for: sequence
-
Plasmid#126724PurposeLacI-Gal4AD on pPICZ B expression vectorDepositorInserthybrid lacI-Gal4 activation domain coding sequence
ExpressionYeastPromoterICL1Available SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-N entry vector
Plasmid#111751PurposeIntermediate vector containing HTT gene, except for polyQ region. Used to clone various polyQ lengths into HTT sequence with N-term FLAG tag. Baculovirus transfer vector for insect and mammalian cellsDepositorTypeEmpty backboneUseBaculovirus expressionTagsFLAGExpressionMammalianAvailable SinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28B-PU.1-ETS-Loop
Plasmid#124551PurposeChimeric ETS domain: Loop of Ets-1 in PU.1 scaffoldDepositorTags6xHis tagExpressionBacterialMutationResidues 216 to 223 replaced with corresponding s…Available SinceJune 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSB61 - pL0_V2 (CDS1)
Plasmid#123183PurposeGolden Gate (MoClo; CDS1) compatible Tomato yellow leaf curl virus (TYLCV) V2 silencing suppressor based on NCBI Reference Sequence NC_004005DepositorInsertTomato yellow leaf curl virus (TYLCV) V2 (v2 Synthetic)
UsePart for plant expressionExpressionPlantMutationNo BpiI and BsaI sitesAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28B-PU.1-ETS-S3
Plasmid#124550PurposeChimeric ETS domain: S3 of Ets-1 in PU.1 scaffoldDepositorTags6xHis tagExpressionBacterialMutationResidues 242 to 246 replaced with corresponding s…Available SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28b-PU.1-ETS-H2
Plasmid#123358PurposeChimeric ETS domain: H2 of Ets-1 in PU.1 scaffoldDepositorTags6xHis tagExpressionBacterialMutationResidues 207 to 215 replaced with corresponding s…Available SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pIDS-LSD1-C
Plasmid#109160PurposeEncodes a human C-terminal LSD1 fragment to be expressed in a baculovirus/insect cell expression systemDepositorInserthuman C-terminal LSD1, sequence-optimized for insect cells (KDM1A Human)
ExpressionInsectPromoterp10Available SinceJan. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
Dscam1_7.27.26 EC10-Fc-His
Plasmid#72189PurposeExpresses the 10 N-terminal extracellular domains of the Dscam, isoform 7.27.26 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertDscam1_7.27.26
TagsFc-HisExpressionMammalianPromoterCMVAvailable SinceJan. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
Dscam1_7.27.23 EC10-Fc-His
Plasmid#72187PurposeExpresses the 10 N-terminal extracellular domains of the Dscam, isoform 7.27.23 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertDscam1_7.27.23
TagsFc-HisExpressionMammalianPromoterCMVAvailable SinceJan. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
Dscam1_7.27.26 EC10-AP-His
Plasmid#72063PurposeExpresses the 10 N-terminal extracellular domains of the Dscam, isoform 7.27.26 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertDscam1_7.27.26
TagsAP-HisExpressionMammalianPromoterCMVAvailable SinceJan. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
rd
Plasmid#112912PurposeExpress the PEST domain-replaced 48 kDa form of human dematin with a cleavable N-terminal GST tagDepositorInsertdematin (DMTN Human)
TagsGlutatione-S-Tranferase and precision protease si…ExpressionBacterialMutationPEST sequence near the N-terminal removed. 5′-GCG…PromoterT7Available SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
Neo1.e-Fc-His
Plasmid#72093PurposeExpresses the extracellular region of the Neogenin 1, isoform e protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-SNCAe3-A53T
Plasmid#85848PurposeDonor plasmid for SNCA exon3 A53T sequence. Also contains EGFP and tagBFPDepositorInsertSNCA exon 3 homology arms (SNCA Human)
ExpressionBacterial and MammalianAvailable SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only