We narrowed to 16,448 results for: GRN
-
Plasmid#139656PurposeEndogenous tagging of PSD95: C-terminal (amino acid position: R721)DepositorInsertgRNA and HaloTag donor
UseAAVExpressionMammalianPromoterU6Available SinceJune 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Syt7 KI
Plasmid#131488PurposeEndogenous tagging of Synaptotagmin-7: N-terminal (amino acid position: P5)DepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mCsnk2b - 1
Plasmid#198505Purposelentiviral stable expression of mCsnk2b gRNA 1DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAT077
Plasmid#180511PurposePlasmid expressing mammalian codon optimized wt PlmCasX, sgRNAv2 scaffold, and restriction sites to clone in new spacersDepositorInsertsCasX sgRNAv2
PlmCasX
UseCRISPRTags2x FLAG and SV40 NLSExpressionMammalianPromoterCAG and U6Available SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRDA355_sgCiPELO #2
Plasmid#229020PurposeExpression of a CRISPRi doxycycline inducible guide targeting PELODepositorInsertPELO gRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgNTC13-hygro
Plasmid#231988PurposeKnockout non-targeting controlDepositorInsertsgRNA with Cas9 and hygromycin resistance
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV ORANGE Gria1-HaloTag KI
Plasmid#139655PurposeEndogenous tagging of GluA1: C-terminal (amino acid position: STOP codon)DepositorInsertgRNA and HaloTag donor
UseAAVExpressionMammalianPromoterU6Available SinceJune 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgNTC49-puro
Plasmid#231989PurposeKnockout non-targeting controlDepositorInsertsgRNA with Cas9 and hygromycin resistance
UseCRISPR and LentiviralAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUG-natNT2
Plasmid#110922Purposeexpression of nat gene conferring resistance to nourseothricin for gene deletion in yeastDepositorInsertnat
ExpressionBacterial and YeastPromoterAgTEF1Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
POLR2A-N CRISPR pX330
Plasmid#124495PurposeA CRISPR plasmid for targeting the N-terminus coding region of human POLR2ADepositorInsertPOLR2A targeting CRISPR
UseCRISPRPromoterU6 promoterAvailable SinceApril 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV.minBG-EGFP-W3SL_2x-U6-sasgAi14
Plasmid#231365PurposeminBG-driven EGFP, also encoding U6-driven sgRNAs to direct saCas9 to both sides of stop cassette in Ai14 mice.DepositorInsertEGFP
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Ple155-CI-EGFP-W3SL_2x-U6-sasgAi14
Plasmid#231366PurposePle155-driven EGFP, also encoding U6-driven sgRNAs to direct saCas9 to both sides of stop cassette in Ai14 mice.DepositorInsertEGFP
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:dCas9:SRDX:Tnos (GB1188)
Plasmid#160608PurposeTU for the expression of the dCas9 with the repressor domain SRDX as a CT fusion (CRISPR tools)DepositorInsertP35s:dCas9:SRDX:tNOS
UseSynthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSCL758
Plasmid#219504PurposeExpress Eco3RT from a CAG promoter; also express an msr and HEK3, FANCF and EMX1 retron msd donor-gRNAs from a single H1 promoter, separated by tRNA-Cys-GCA sequencesDepositorInsertmsr and HEK3, FANCF and EMX1 retron msd donor-gRNAs from a single H1 promoter, separated by tRNA-Cys-GCA sequences
ExpressionMammalianPromoterH1Available SinceMay 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-deSpCas9
Plasmid#92114PurposeExpression plasmid for human codon-optimized dead/inactive increased fidelity eSpCas9 (1.1) (without U6-sgRNA coding sequence)DepositorInsertdead/inactive eSpCas9 with FLAG tag
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationD10A, H840A, K848A, K1003A, R1060APromoterCbhAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-70kb-DSF
Plasmid#227498Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 70kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCas9-sgVRK1 #4-Blast
Plasmid#199647PurposeExpresses Cas9 and sgRNA guide targeting VRK1DepositorInsertN/A (VRK1 Human)
UseLentiviralAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAT105
Plasmid#180510PurposePlasmid expressing mammalian codon optimized engineered DpbCasX-R3, sgRNAv2 scaffold, and restriction sites to clone in new spacersDepositorInsertsCasX sgRNAv2
DpbCasX with R3 loop
UseCRISPRTags2x FLAG and SV40 NLSExpressionMammalianPromoterCAG and U6Available SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only