We narrowed to 14,068 results for: crispr grnas
-
Plasmid#170548PurposeExpresses a sgRNA for 5' tagging to VIM and contains a cassette with eGFP without homology armsDepositorInsertsgRNA targeting 5'- end of VIM
UseCRISPR and LentiviralPromoterU6Available SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
cBEST2
Plasmid#234658PurposeExpresses cytosine base editor - spCas9n (D10A) fused to APOBEC1 and UGI, Include Golden Gate compatible cassette for sgRNA insertionDepositorInsertsspCas9 cytosine base editor
Golden Gate compatible sgRNA insertion cassette
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterkasO*17tss and kasOp*Available SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKRG3-mU6-PUb-3xFLAG-hSpCas9
Plasmid#162161PurposeExpresses 3xFLAG tagged hSpCas9 (Ae. aegypti PUb promoter) with cloning site for sgRNAs (Ae. aegypti U6 promoter)DepositorInsertshSpCas9
sgRNA
UseCRISPRTags3xFLAGExpressionInsectPromoterAe. aegypti PUb and Ae. aegypti U6Available SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKRG3-mU6-PUb-hSpCas9-pAc
Plasmid#162163PurposeExpresses hSpCas9-T2A-pAc (Ae. aegypti PUb promoter) with cloning site for sgRNAs (Ae. aegypti U6 promoter); puromycin selectableDepositorInsertshSpCas9
sgRNA
UseCRISPRTagsT2A-pAcExpressionInsectPromoterAe. aegypti PUb and Ae. aegypti U6Available SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRI018-pKW20088-PelcA-mCherry-TtrpC-PU3-E1-Cas9Scaffold-8xT
Plasmid#140205PurposeProof-of-concept of CRISPR/dSpCas9-VPR activation, encoding PelcA-mCherry along with the sgRNA E1 expression cassette, targeting PelcA.DepositorInsertsmCherry
sgRNA E1
UseCRISPR and Synthetic Biology; Proof-of-concept te…MutationG174DPromoterPelcA and U3Available SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDIV515
Plasmid#177703PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV537
Plasmid#177704PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting KU70 homolog in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEE393
Plasmid#149283PurposeT-DNA encoding TRV2 with Truncated FT augmented gRNA targeting NbPDS3DepositorInsertp35S:TRV2_NbPDS3sgRNA_TrunFT:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPEG
Plasmid#162466PurposeEntry vector for gRNA insertion in plant prime editing expression vectorDepositorTypeEmpty backboneUseEntry vector for grnaPromoterCmYLCVAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBWB424
Plasmid#140638PurposeRSF1010-Cas9-vanAB gRNA. Vector with constitutive Cas9 and gRNA targeting vanAB locus.DepositorInsertCas9
ExpressionBacterialAvailable SinceMay 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBWB419
Plasmid#140637PurposeRSF1010-Cas9-pcaHG gRNA. Vector with constitutive Cas9 with gRNA targeting pcaHG locus.DepositorInsertCas9
ExpressionBacterialAvailable SinceMay 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEE491
Plasmid#149292PurposeT-DNA encoding TRV2 with tRNA multiplexed truncated FT augmented gRNAs targeting NbAGsgRNA1, NbPDS3, NbAGsgRNA2DepositorInsertp35S:TRV2_tRNA_NbAGsgRNA1_NbPDS3sgRNA_NbAGsgRNA2_TrunFT:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEE531
Plasmid#149290PurposeT-DNA encoding TRV2 with spacer multiplexed truncated FT augmented gRNAs targeting NbAGsgRNA1, NbPDS3, NbAGsgRNA2DepositorInsertp35S:TRV2_Spacer_NbAGsgRNA1_NbPDS3sgRNA_NbAGsgRNA2_TrunFT:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEE495
Plasmid#149291PurposeT-DNA encoding TRV2 with direct repeat multiplexed truncated FT augmented gRNAs targeting NbAGsgRNA1, NbPDS3, NbAGsgRNA2DepositorInsertp35S:TRV2_Direct_NbAGsgRNA1_NbPDS3sgRNA_NbAGsgRNA2_TrunFT:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEE389
Plasmid#149287PurposeT-DNA encoding TRV2 with Truncated FT augmented gRNA targeting NbAGDepositorInsertp35S:TRV2_NbAGsgRNA1_TrunFT:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEE385
Plasmid#149289PurposeT-DNA encoding TRV2 with Truncated FT augmented gRNA targeting NbAGDepositorInsertp35S:TRV2_NbAGsgRNA2_TrunFT:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
E42_gControl_dTet_IRES_mTurquoise2
Plasmid#189799PurposeRetroviral delivery of control guide RNADepositorInsertLuciferase gRNA
UseRetroviralAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHLS-EF1a-FRB-SpCas9-A
Plasmid#138477PurposeExpresses FRB fused SpCas9 for NanoMEDIC packaging.DepositorInsertSpCas9, human codon optimized
UseCRISPRTags3x HA tag and FRBExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRL1
Plasmid#153997PurposesgRNA in vitro transcription plasmid.DepositorTypeEmpty backboneUseCRISPR; Sgrna under a t7 promoter for in vitro tr…PromoterT7Available SinceJune 29, 2020AvailabilityAcademic Institutions and Nonprofits only