-
Plasmid#127199PurposePlasmid expressing sgRNA2 (TACCACATTTGTAGAGGTT) & sgRNA3 (CAATGTATCTTATCATGTC) as polycistronic tRNA-gRNA from single U6 promoterDepositorInserttRNA-gRNA
UseEmpty sgrna plasmidTagsExpressionMammalianMutationPromoterU6Available sinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti_dCas9-2xAM_hIRF-1
Plasmid#92221PurposeLentiviral plasmid expressing dCas9-2xAM and gRNA for human IRF-1 promoterDepositorInsertsSp-dCas9-2xAM tag
gRNA targeting human IRF-1 promoter
UseCRISPR and LentiviralTags2xAM tagExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterCBh and U6Available sinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_MTOR_Nick_Exon-53_Dual_sgRNA
Plasmid#178107PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G8 and MTOR Nick exon-53 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G8 + MTOR nick exon-53 sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_Tuba1b sgRNA / hSpCas9
Plasmid#172835PurposeMammalian expression of a sgRNA targeting the intron 1 of Tuba1b (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of Tuba1b under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G6_T804N_MTOR_E2419K_Dual_pegRNA
Plasmid#178110PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 T804N-G6 and MTOR-E2419K pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G6 T804N pegRNA + MTOR-E2419K pegRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pB-puro-mU6-CNPshRNA1
Plasmid#126611PurposeExpresses shRNA against human CNP under mouse U6 promoterDepositorInsertCNP ShRNA-1 (CNP Human)
UseRNAiTagsExpressionMutationPromotermouse U6 promoterAvailable sinceJune 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_RUNX1_Nick-38_Dual_sgRNA
Plasmid#173214PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and RUNX1 nick-38 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 sgRNA + RUNX1 Nick-38 sgRNA
UseCRISPR; Prime editing (pe3)TagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_CALR sgRNA / hSpCas9
Plasmid#172838PurposeMammalian expression of a sgRNA targeting the intron 1 of CALR (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of CALR under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-wtSpCas9 (without sgRNA)
Plasmid#92353PurposeExpression plasmid for human codon-optimized wild-type SpCas9 (without U6-sgRNA coding sequence)DepositorInsert3xFlag-NLS-wild-type SpCas9-NLS
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationPromoterCbhAvailable sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pDECKO-mCherry TFRC_B
Plasmid#78544PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralTagsExpressionMammalianMutationPromoterU6 and U6 (for expressing sgRNA)Available sinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-2
Plasmid#121423PurposesgYAP-2 sequence: GAGATGACTTCCTGAACAGTG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-2
UseCRISPR and LentiviralTagsmCherryExpressionMammalianMutationPromotermouse U6Available sinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAPcrRNA_Eco
Plasmid#106276PurposeE.coli CRISPR Type I-E crRNA cloning vector for mammalian expression driven by U6 promoterDepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pDECKO-mCherry MALAT1_Exon.2
Plasmid#78541PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralTagsExpressionMammalianMutationPromoterU6 (for expressing sgRNA) and U6 promoterAvailable sinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry MALAT1_Exon.4
Plasmid#78543PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralTagsExpressionMammalianMutationPromoterU6 and U6 (for expressing sgRNA)Available sinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV.5’eGFP/sgVIM
Plasmid#170548PurposeExpresses a sgRNA for 5' tagging to VIM and contains a cassette with eGFP without homology armsDepositorInsertsgRNA targeting 5'- end of VIM
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCA28-pMa-PspCas13b crRNA-TS1
Plasmid#199459PurposeU6-driven crRNA targeting TS1 sequence (CCTCCTCGGAGAGCATCGGTGC )DepositorInsertTS1 crRNA
UseCRISPRTagsExpressionMutationPromotermouse U6Available sinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTij_sg_mmu_Med6_C_terminal
Plasmid#197869PurposeCRISPR/Cas9/sgRNA plasmid for cutting Med6 C terminal and building MED6-mEmerald/Halo knock-in mESCsDepositorInsertMed6 (Med6 Mouse)
UseTagsExpressionMammalianMutationPromoterU6Available sinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKSB-AeU6-1gRNA
Plasmid#183912PurposegRNA-expressing plasmid under Aedes aegypti AAEL017702 U6 promoterDepositorInsertgRNA scaffold for protospacer cloning into BbsI sites
UseTagsExpressionMutationPromoterAedes aegypti U6 promoter (AAEL017702)Available sinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only