We narrowed to 24,948 results for: Spr
-
Plasmid#193780PurposeTricistronic expression of Cas9-mApple-BSD in mammalian cellsDepositorInsertmApple
UseLentiviralExpressionMammalianPromoterIn frame with Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJSC270 - Bacterial expression plasmid for SpCas9 eSpCas9(1.1)-HF1 variant
Plasmid#101217PurposeBacterial expression plasmid for SpCas9 eSpCas9(1.1)-HF1 variantDepositorInsertSpCas9 variant K848A/K1003A/R1060A/N497A/R661A/Q695A/Q926A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationK848A, K1003A, R1060A, N497A, R661A, Q695A and Q9…PromoterT7Available SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMB953:PB-CAG-PuroR-nGFP-FLEx-mCherry-KASH-WPRE
Plasmid#168106PurposePiggyBac transposon vector constitutively driving PuroR-P2A-eGFP and Cre conditional expression of KASH nuclear membrane-bound mCherry. Conditional insert flanked by MCS for cloningDepositorInsertmCherry-KASH
UseCRISPR and Cre/LoxPromoterCAGAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7748 mU6: Spy sgTET || CMV: mCherry~P2A-DD-A4
Plasmid#123657PurposeDD-AcrIIA4 fusion for Shield1-mediated AcrIIA4 control with sgRNA driving TRE3G activation.DepositorInsertmCherry-P2A-DD-AcrIIA4
UseCRISPR, Lentiviral, and Synthetic BiologyTagsmCherry-P2AExpressionMammalianPromoterCMV and mU6Available SinceApril 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-mitf
Plasmid#69801PurposeUsed to make mitf knockout porcine cell lineDepositorInsertsmitf-sgRNA
SpCas9
ExpressionMammalianPromoterChicken Beta-Actin and U6Available SinceDec. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJEP14-AAV-H1/TO-sgRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82702PurposeAAV backbone with a minimal H1/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-sTagRFP-TUBA1B
Plasmid#207769PurposeDonor template for Puro-2A-sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Puro-sTagRFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
plenti-px330-CRBN-T2-pGK-Pur
Plasmid#107383PurposeMammalian expression CRISPR/Cas9DepositorAvailable SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBZCas13b-HEPN
Plasmid#89901PurposeBacterial expression for bzCas13b and crRNA with both HEPN domains mutated. New spacers can be cloned by digesting with BsaI.DepositorInsertCas13b
ExpressionBacterialMutationR116A/H121A/R1177A/H1182APromoterLacAvailable SinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_EIF2AK2
Plasmid#106108PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting EIF2AK2DepositorInsertgRNA targeting EIF2AK2 (EIF2AK2 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1a-SPdCas9-DNMT3B-2A-Blast
Plasmid#71217PurposedCas9 fused to human DNMT3B catalytic domainDepositorInsertdSpCas9-DNMT3B catalytic domain
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgGria1
Plasmid#124867PurposeMutagenesis of Gria1DepositorInsertGria1 (Gria1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97308PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HMEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hASCL1 gRNA_multi1-3-MS2-Puro
Plasmid#192682PurposeLentiviral expression of multi gRNAs targeting hASCL1 promoter to activate human ASCL1 transcriptionDepositorInsertHuman ASCL1 activating gRNAs #1,2,3 (ASCL1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
hA3A-BE3 (pRZ215)
Plasmid#131314PurposeCAG promoter expression plasmid for hA3A-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP.DepositorInserthA3A-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP
ExpressionMammalianPromoterCAGAvailable SinceOct. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGria3
Plasmid#124855PurposeMutagenesis of Gria3DepositorInsertGria3 (Gria3 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187945PurposedCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertSpdCas9-tagRFPt-P2A-tagBFP
UseSynthetic Biology; PiggybacTagsNLS, NLS + HA-tag, P2A, tagBFP, and tagRFPtExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJSC129 - Bacterial expression plasmid for SpCas9-HF1, REC2 FRET variant
Plasmid#101211PurposeBacterial expression plasmid for SpCas9-HF1, REC2 FRET variantDepositorInsertSpCas9 variant C80S/C574S/E60C/D273C/N497A/R661A/Q695A/Q926A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationC80S, C574S, E60C, D273C, N497A, R661A, Q695A and…PromoterT7Available SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJSC057 - Bacterial expression plasmid for SpCas9∆REC3, REC2 FRET variant
Plasmid#101204PurposeBacterial expression plasmid for SpCas9∆REC3, REC2 FRET variantDepositorInsertSpCas9 variant C80S/C574S/E60C/D273C/M1–N497,GGS,V713–D1368
Tags10x His, MBP, and TEV siteExpressionBacterialMutationC80S, C574S, E60C, D273C, M1-N497, GGS, V713-D1368PromoterT7Available SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only