We narrowed to 16,983 results for: tes
-
Plasmid#153308PurposeExpresses GPI-anchored dL5** in mammalian cells. (FAP-GPI)DepositorInsertIgKappa-myc-dL5-2XG4S-GPI
Tagsmyc-dL5ExpressionMammalianPromoterCMVAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.3−3xFLAG−AGO2(S387A)
Plasmid#220462PurposeExpress S387 phospho-null mutant human AGO2 with N-terminal 3xFLAG tag in mammalian cellsDepositorInsertHuman AGO2 (AGO2 Human)
Tags3xFLAGExpressionMammalianMutationSerine 387 to alaninePromoterCMVAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.3−3xFLAG−AGO2(S387D)
Plasmid#220463PurposeExpress S387 phosphomimetic mutant human AGO2 with N-terminal 3xFLAG tag in mammalian cellsDepositorInsertHuman AGO2 (AGO2 Human)
Tags3xFLAGExpressionMammalianMutationSerine 387 to aspartatePromoterCMVAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ-p21-HA(dPCNA)
Plasmid#215112PurposeExpresses p21-HA(dPCNA) in mammalian cells from an inducible lentiviral vector.DepositorInsertCDKN1A (CDKN1A Human)
UseLentiviralTagsHAExpressionMammalianMutationp21(dPCNA) denotes mutations M147A, D149A, F150A.PromoterCMV (Tet inducible)Available SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-ARNTL-shRNA3
Plasmid#166915PurposeLentivirus for inducible knockdown of human ARNTL(BMAL1)DepositorAvailable SinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SMARCA2(47))-PGKpuro2ABFP-W
Plasmid#200510PurposeLentiviral vector expressing gRNA targeting human SMARCA2DepositorInsertSMARCA2(47) (SMARCA2 Human)
UseLentiviralAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SMARCA2(46))-PGKpuro2ABFP-W
Plasmid#200465PurposeLentiviral vector expressing gRNA targeting human SMARCA2DepositorInsertSMARCA2(46) (SMARCA2 Human)
UseLentiviralAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-RIPK3[V458A][Q459A][V460A][G461A]-FLAG
Plasmid#199328Purposemutated RHIM motive (interaction inhibited)DepositorInsertReceptor-interacting serine/threonine-protein kinase 3 (RIPK3 Human)
TagsFLAGExpressionMammalianMutationchanged V458, Q459,V460 and G461 to alanineAvailable SinceJune 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-PAL2
Plasmid#196691PurposeRep/Cap plasmid for the production of PAL2, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationPTQGTVR insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_1kb_KLF2mut 899
Plasmid#194193PurposeIncludes the promoter (1kb) of SMTS with mutated KLF binding sites (position 899)DepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseMutationmutated KLF binding sites (position 899)PromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-mLepr-COMP5AP-AviTag-9xHis
Plasmid#157628PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-mCherry-TSC2-NLS
Plasmid#192441PurposeEncodes mCherry-tagged wild-type TSC2 isoform 5 targeted to the nucleus.DepositorInsertmCherry-TSC2-NLS (TSC2 Human)
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Linked Free NES (M)
Plasmid#182436PurposeYeast integrative plasmid for expressing fusion protein ERG20(F96W-N127W)-AcNES1 (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertFPPS(M)-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Sa-gRNA-puro
Plasmid#191652PurposeLentiviral expression of puromycin resistance gene and S. aureus scrambled non-targeting gRNA ; useful for changing gRNA by mutagenesis.DepositorInsertS. aureus gRNAscr
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-FLAG-IRES-blasticidin-Sox2 S248A/T258A
Plasmid#182049Purposeexpression of Sox2 mutantsDepositorAvailable SinceApril 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-α-COPI-WD40
Plasmid#180758PurposeMammalian expression plasmid for Schizosaccharomyces pombe α-COPI-WD40 (residues 1-327)DepositorInsertα-COPI-WD40
TagsC-terminal strep tagExpressionMammalianMutationEncodes residues 1-327; mutations: Leu181Lys, Leu…PromoterCMVAvailable SinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
W118-1_hRSK3(RPS6KA2)_K91A_K444A
Plasmid#180385Purposelentiviral transduction of human RSK3 (RPS6KA2) gene with point mutations (K91A and K444A) that inactivate kinase activityDepositorInsertRPS6KA2_K91A/K444A (RPS6KA2 Human)
UseLentiviralExpressionMammalianMutationK91A/K444APromoterCMVAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-S (B.1.351 lineage / South African variant)
Plasmid#169849PurposeMammalian expression plasmid for S of SARS-CoV-2 (B.1.351 lineage / South African variant) with N-terminal c-myc tagDepositorInsertProtein S
TagsHA leader and c-myc tagExpressionMammalianMutationCodon-optimized for human cell expression.PromoterCMVAvailable SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTXBI-mClover-YTH domain
Plasmid#177123PurposeBacterial expression of YTH domain of YTHDC1 tagged with N-terminal mClover3 and C-terminal Mxe GtrA intein-Chitin binding domain for protein purificationDepositorInsertYTHDC1 (YTH domain) (YTHDC1 Human)
TagsMxe GyrA intein-Chitin binding domain for protein…ExpressionBacterialMutationYTH domain only (IDR1 and IDR2 deletion)PromoterT7Available SinceJan. 10, 2022AvailabilityAcademic Institutions and Nonprofits only