We narrowed to 3,367 results for: aaas
-
Plasmid#175858PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertCHCHD3-Nickase2
UseCRISPRAvailable SinceOct. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOCC102-MBP-eIF4G-213
Plasmid#219974PurposeeIF4G-213 protein purificationDepositorInserteIF4G-213 (TIF4631 Budding Yeast)
Tags6xHis-MBPExpressionInsectMutation213VKLR216 to 213AAAA216Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13209
Plasmid#219884PurposeThe base plasmid of TUNEYALI for TF19DepositorInsertContains gRNA targeting TF19 (YALI1_A20855g) and homologous arm matching TF19
ExpressionYeastAvailable SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13229
Plasmid#219904PurposeThe base plasmid of TUNEYALI for TF39DepositorInsertContains gRNA targeting TF39 (YALI1_B16808g) and homologous arm matching TF39
ExpressionYeastAvailable SinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13212
Plasmid#219887PurposeThe base plasmid of TUNEYALI for TF22DepositorInsertContains gRNA targeting TF22 (YALI1_C25288g) and homologous arm matching TF22
ExpressionYeastAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPHTF2.1.0-gDNA
Plasmid#132465PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertPHTF2 (PHTF2 Human)
UseCRISPRAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZNF3_2
Plasmid#72364PurposeEncodes gRNA for 3' target of human ZNF3 along with Cas9 with 2A GFPDepositorInsertZNF3 (ZNF3 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-PHGDH-int1
Plasmid#188681Purposecontrol sgRNADepositorAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRARB.1.0-gDNA
Plasmid#132471PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertRARB (RARB Human)
UseCRISPRAvailable SinceDec. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJR255
Plasmid#78549PurposeFor expressing small noncoding RNAs from U6 promoter. One step cloning of oiigonucleotide pairs containing CACC and AAAA overhangs. CMV driven mCherry visible marker.DepositorTypeEmpty backboneUseRNAiExpressionMammalianPromoterU6, CMVAvailable SinceJan. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJK217
Plasmid#72471PurposeProduces Acetobacter aceti 1023 citrate synthase with N-terminal His6 tag (H6AaAarA)DepositorInsertcitrate synthase
TagsHis6ExpressionBacterialPromoterT7Available SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHuR CDS
Plasmid#110426PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene and express monomeric Kusabira-Orange2.DepositorInsertELAVL1 HuR
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_SEO1
Plasmid#166076PurposePlasmid for constituive spCas9 and tet-inducible SEO1 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-CDK1
Plasmid#188684Purposecontrol sgRNADepositorAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_RRT8
Plasmid#166080PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RRT8 for double stranded break formation in yeast.DepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJR288
Plasmid#78550PurposeFor expressing small noncoding RNAs from U6 promoter. One step cloning of oiigonucleotide pairs containing CACC and AAAA overhangs. Ef1a driven mCherry visible marker.DepositorTypeEmpty backboneUseRNAiExpressionMammalianPromoterU6, EF1aAvailable SinceJan. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only