-
Plasmid#196609PurposesiRNA vector expressing TMV P19 and a 720-long EGFP sequence as inverted repeatDepositorInsertp19 + EGFP inverted repeat sequence
UseTags6x His tagExpressionBacterialMutationPromoterAraCAvailable sinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAD-P19-NP
Plasmid#196608PurposesiRNA vector expressing TMV P19 and a 425bp-long NP sequence as inverted repeatDepositorInsertp19 + Influenza virus NP inverted repeat
UseTags6x His tagExpressionBacterialMutationPromoterAvailable sinceMay 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHcRed-CLCa
Plasmid#196911Purposevisualization of clathrin-coated vesicle in living mammalian cellsDepositorInsertClathrin-Coated light chain
UseTagsHcRedExpressionMammalianMutationPromoterCMVAvailable sinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-3xHAtag-SP-CLSTN2
Plasmid#191694PurposeFor expression coding sequencing of CLSTN2DepositorInsertsignal peptide, 3xHAtag and full length coding sequence of CLSTN2
UseTagsExpressionMammalianMutationWTPromoterAvailable sinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-SP-3xHAtag-PTPRO
Plasmid#191695PurposeFor expression coding sequencing of PTPRODepositorInsertsignal peptide, full length coding sequence of PTPRO and 3xHAtag
UseTagsExpressionMammalianMutationWTPromoterAvailable sinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPtrcAvailable sinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailable sinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056H
Plasmid#183135PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRTagsExpressionInsectMutationPromoterAvailable sinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056J
Plasmid#183136PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRTagsExpressionInsectMutationPromoterAvailable sinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056K
Plasmid#183137PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRTagsExpressionInsectMutationPromoterAvailable sinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR207-MUM2sp-PelA
Plasmid#170722PurposeGateway (Invitrogen) entry clone (pDONR207) containing the MUM2 (At5g63800) signal peptide (84bp) fused in-frame to the coding sequence of the HG degrading enzyme PelA (AN2331.2)DepositorInsertPectin lyase A
UseGateway donor vector / entry cloneTagsExpressionMutationPromoterAvailable sinceOct. 20, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR207-MUM2sp-RglB
Plasmid#170721PurposeGateway (Invitrogen) entry clone (pDONR207) containing the MUM2 (At5g63800) signal peptide (84bp) fused in-frame to the coding sequence of the RG-I degrading enzyme RglB (AN6395.2)DepositorInsertRhamnogalacturonan lyase B
UseGateway donor vector / entry cloneTagsExpressionMutationPromoterAvailable sinceOct. 20, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR207-MUM2sp-RglA
Plasmid#170720PurposeGateway (Invitrogen) entry clone (pDONR207) containing the MUM2 (At5g63800) signal peptide (84bp) fused in-frame to the coding sequence of the RG-I degrading enzyme RglA (AN7135.2)DepositorInsertRhamnogalacturonan lyase A
UseGateway donor vector / entry cloneTagsExpressionMutationPromoterAvailable sinceOct. 20, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMP71-mGFP-LLO-hPMEL
Plasmid#174607Purposeexpresses palmitoylated GFP with a C terminal fusion of the LLO190 epitope and the human hPMEL epitopeDepositorInsertexpresses palmitoylated GFP w/C-term fusion of the LLO190 epitope and human hPMEL epitope
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
Dcp2 ΔH1 Δ5H
Plasmid#163582Purposeexpress Dcp2 ΔH1 Δ5H at endogenous level in S.cerevisiaeDepositorInsertDcp2 (DCP2 Budding Yeast)
UseTagsGFPExpressionYeastMutationL255A; mutate 440-450, 489-500, 701-708, 827-831,…PromoterDCP2 promoterAvailable sinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
Dcp2C Δ5H
Plasmid#163581Purposeexpress Dcp2C Δ5H at endogenous level in S.cerevisiaeDepositorInsertDcp2 (DCP2 Budding Yeast)
UseTagsGFPExpressionYeastMutationTruncation of aa1-300; mutate aa440-450, aa489-50…PromoterDCP2 promoterAvailable sinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUASTLOTattB_vhhGFP4::Nrv1::tagBFP
Plasmid#163925PurposeExpression of GrabFP-B-extracellular under control of UAS or LOP enhancerDepositorInsertFusion of vhhGPF4 (extracellular) nanobody with Nrv1 protein and tagBFP fluorophor
UseCre/LoxTagstagBFPExpressionInsectMutationPromoterAvailable sinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shSpc25
Plasmid#160960PurposeSpc25 shRNA in pMKO.1 retroviral vectorDepositorInsertSpc25 shRNA (Spc25 Mouse)
UseRNAi and RetroviralTagsExpressionMutationPromoterU6Available sinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSC45
Plasmid#104819PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-2). Also expresses Cas9 from Gmubi promoter.DepositorInsertGlyma.04g057400
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC29
Plasmid#104803PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr4g094545 (Hen1). Also expresses Cas9 from Gmubi promoter.DepositorInsertMedtr4g094545
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only