We narrowed to 41,019 results for: kan
-
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313-rad53-5004
Plasmid#232902PurposePlasmid carrying the rad53-5004 allele with its native promoter and terminator.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEG302-MSI1-ZF
Plasmid#200912PurposeExpress MSI1-ZF108 in Arabidopsis target FWA geneDepositorInsertMSI1 (MSI1 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-HD2C-ZF
Plasmid#200917PurposeExpress HD2C-ZF108 in Arabidopsis target FWA geneDepositorInsertHD2C (HD2C Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-CPL2-ZF
Plasmid#200918PurposeExpress CPL2-ZF108 in Arabidopsis target FWA geneDepositorInsertCPL2 (CPL2 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-JMJ18-ZF
Plasmid#200919PurposeExpress JMJ18-ZF108 in Arabidopsis target FWA geneDepositorInsertJMJ18 (JMJ18 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-ELF7-ZF
Plasmid#200920PurposeExpress ELF7-ZF108 in Arabidopsis target FWA geneDepositorInsertELF7 (ELF7 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMDC123-DMS3-ZF
Plasmid#200921PurposeExpress DMS3-ZF108 in Arabidopsis target FWA geneDepositorInsertDMS3 (DMS3 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMDC123-SUVH2-ZF
Plasmid#200922PurposeExpress SUVH2-ZF108 in Arabidopsis target FWA geneDepositorInsertSUVH2 (SUVH2 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMDC123-SUVH9-ZF
Plasmid#200923PurposeExpress SUVH9-ZF108 in Arabidopsis target FWA geneDepositorInsertSUVH9 (SUVH9 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
R6K_tac_mCherry_ChInt
Plasmid#187382Purposechromosomal integration downstream of glmS gene via Tn7 system of a cassette containing IPTG-inducible mCherryDepositorInsertmCherry
ExpressionBacterialAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
R6K_tac_GFPmut3_ChInt
Plasmid#187381Purposechromosomal integration downstream of glmS gene via Tn7 system of a cassette containing IPTG-inducible GFPmut3DepositorInsertGFPmut3
ExpressionBacterialAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
R6K_BAD_GFP-mCherry_ChInt++
Plasmid#187393Purposechromosomal integration downstream of glmS gene via Tn7 system of a cassette encoding for arabinose-inducible GFP and mCherryDepositorInsertGFP, mCherry
ExpressionBacterialAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
R6K_BAD_GFP-mCherry_ChInt--
Plasmid#187394Purposechromosomal integration downstream of glmS gene via Tn7 system of a cassette encoding for arabinose-inducible GFP and mCherryDepositorInsertGFP, mCherry
ExpressionBacterialAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
R6K_BAD_mCherry-GFP_ChInt--
Plasmid#187396Purposechromosomal integration downstream of glmS gene via Tn7 system of a cassette encoding for arabinose-inducible GFP and mCherryDepositorInsertGFP, mCherry
ExpressionBacterialAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only