We narrowed to 25,346 results for: Spr
-
Plasmid#124869PurposeMutagenesis of Gria3DepositorInsertGria3 (Gria3 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_CELF2
Plasmid#106102PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting CELF2DepositorInsertgRNA targeting CELF2 (CELF2 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV_3xgRNA;PTENA, p53B,SMAD4A_CAG_FlPO_synthPA
Plasmid#68346PurposeUsed to produce AAV expressing the FlpO recombinase and pig gRNA towards 3 tumor suppressors: PTEN, p53 and SMAD4DepositorInserts3xgRNA;PTENA, p53B,SMAD4A
FlPO
UseAAV; Flp/frtExpressionMammalianPromoterCAG and U6Available SinceDec. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
AcrIIC1X* (AcrIIC1X-mCherry chimera)
Plasmid#128114PurposeExpresses AcrIIC1(N3F/D15Q/A48I) fused to mCherry; mediates potent inhibition of both, N. meningitidis as well as S. aureus Cas9DepositorInsertAcrX* (AcrIIC1 N3F/D15Q/A48I fused to mCherry)
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMVAvailable SinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_CELF1
Plasmid#106101PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting CELF1DepositorInsertgRNA targeting CELF1 (CELF1 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-KLF17-CRa1-MS2
Plasmid#251117PurposesgRNA1 for KLF17 activation cloned into lenti sgRNA(MS2)_puro backboneDepositorInsertsgRNA1 targeting KLF17 promoter (KLF17 Human, Synthetic)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-KLF17-CRa2-MS2
Plasmid#251118PurposesgRNA2 for KLF17 activation cloned into lenti sgRNA(MS2)_puro backboneDepositorInsertsgRNA2 targeting KLF17 promoter (KLF17 Human, Synthetic)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLCV2-AAVS1(hU6-sg1-mU6-sg2)-Blast
Plasmid#208343PurposepLentiCRISPRv2-Blast backbone with two separate sgRNAs against AAVS1. Serves as a negative control by targeting a safe harbor locus.DepositorArticleAvailable SinceJan. 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCAG-48xEFNA1 array
Plasmid#236382PurposeExpression of array of 48 crRNAs targeting EFNA1DepositorInsert48xEFNA1 crRNA array (EFNA1 Human)
UseCRISPR and LentiviralAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mScarlet-MAPRE1
Plasmid#227323PurposeDonor template for mScarlet insertion into the C-terminus of the MAPRE1 locus. For growing microtubule tip visualization. To be co-transfected with sgRNA plasmid px330-PITCh-MAPRE1 (Addgene #207793)DepositorInsertMAPRE1 Homology Arms flanking a mScarlet Tag (MAPRE1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-EZR
Plasmid#227294PurposeDonor template for mStayGold insertion into the C-terminus of the EZR locus. For membrane visualization. To be co-transfected with sgRNA plasmid px330-EZR (Addgene #227293)DepositorInsertEZR Homology Arms flanking a mStayGold Tag (EZR Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-H3C2
Plasmid#227334PurposeDonor template for mStayGold insertion into the C-terminus of the H3C2 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 (Addgene #207780)DepositorInsertH3C2 Homology Arms flanking a mStayGold Tag (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-miRFP670nano3-H3C2
Plasmid#227335PurposeDonor template for miRFP670nano3 insertion into the C-terminus of the H3C2 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 (Addgene #207780)DepositorInsertH3C2 Homology Arms flanking a miRFP670nano3 Tag (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-MAP4
Plasmid#227296PurposeDonor template for mStayGold insertion into the N-terminus of the MAP4 locus. For microtubule visualization. To be co-transfected with sgRNAplasmid px330-PITCh-MAP4 (Addgene #227295)DepositorInsertMAP4 Homology Arms flanking a mStayGold Tag (MAP4 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-CEP192
Plasmid#227289PurposeDonor template for mStayGold insertion into the C-terminus of the CEP192 locus. For pericentriolar material visualization. To be co-transfected with sgRNA plasmid px330-PITCh-CEP192 (Addgene #227288)DepositorInsertCEP192 Homology Arms flanking a mStayGold Tag (CEP192 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-crCoV-Mutiplex_EF1a-BFP
Plasmid#224788PurposeSARS-COV-2 targeting crRNA array for RfxCas13d expressed from single hU6 promoter and reporter BFP protein expressed from EF1a promoterDepositorInsertcrCoV20, crCoV21, crCoV24
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6 and hU6-2xTetOAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pICH86966::AtU6p::sgRNA:NbCysP6
Plasmid#223217PurposeExpresses an sgRNA targeting the NbCysP6 gene in Nicotiana benthamiana with an Arabidopsis U6 promoterDepositorInsertNbCysP6 sgRNA
UseCRISPR and Synthetic BiologyTagsNoneExpressionPlantPromoterArabidopsis U6 promoterAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only