We narrowed to 2,914 results for: GFP reporter gene
-
Plasmid#201450PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT3_d2EGFP-mCherry
UseSynthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPLN-hFluc-DM-HA-GFP11-KDEL
Plasmid#177723PurposeDM Firefly luciferase reporter fused to a prolactin signal sequence for ER targeting and KDEL for ER retention with an HA tag and the eleventh β-strand of GFP added to the C-terminusDepositorInserthFlucDM
TagsGFP11, HA, KDEL, and Prolactin Signal SequenceExpressionBacterial and MammalianMutationR188Q, R261Q (Destabilized Mutant)Available SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mEGFP-CaMKIIa (T286A)
Plasmid#127390PurposeFluorescent reporter for mutant Ca2+/calmodulin-dependent protein kinase II alpha (T286A)DepositorInsertcalcium/calmodulin-dependent protein kinase II alpha (Camk2a Rat)
TagsmEGFPExpressionMammalianMutationchanged Threonine 286 to AlaninePromoterpCAGAvailable SinceJan. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mEGFP-CaMKIIa (T286D)
Plasmid#127391PurposeFluorescent reporter for mutant Ca2+/calmodulin-dependent protein kinase II alpha (T286D)DepositorInsertcalcium/calmodulin-dependent protein kinase II alpha (Camk2a Rat)
TagsmEGFPExpressionMammalianMutationchanged Threonine 286 to Aspartic acidPromoterpCAGAvailable SinceJan. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
EW410 IKZF1tar x8-H2B-GFP
Plasmid#236156PurposeFuorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with eight IKZF1 binding sites upstreamDepositorInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianPromoterE1b minimal promoter with eight IKZF1 binding sitā¦Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-M3(T3D)471-721
Plasmid#56657PurposeGFP reporter for cytoplasmic inclusions formed by the fused, C-terminal region of protein muNS from mammalian orthoreovirus Type 3 DearingDepositorInsertM3(T3D)421-721
TagsEGFPExpressionMammalianMutationinsert encodes aa 471-721 + native stop codon of ā¦PromoterCMV-IEAvailable SinceJune 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pAhpC-RBS- sfGFP
Plasmid#190051PurposeGFP containing reporter plasmid expressing it under the control of the OxyR/H2O2 inducible pAhpC promoterDepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGCā¦Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW409 ZNF250tarv3 x8-H2B-GFP
Plasmid#236133PurposeFuorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with eight ZNF250 binding sites upstreamDepositorInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianPromoterE1b minimal promoter with eight ZNF250 binding siā¦Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
SCN1Aprom(1-500)-H2B-GFP
Plasmid#236162PurposeFluorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with the SCN1a promoter region encompassing 500 bp upstream of its transcriptional start siteDepositorInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianPromoterE1b minimal promoter with the SCN1a promoter regiā¦Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pYjjZ-RBS- sfGFP
Plasmid#190054PurposeGFP containing reporter plasmid expressing it under the control of the reportedely OxyR/H2O2 inducible pYjjZ promoterDepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pKatG-RBS- sfGFP
Plasmid#190053PurposeGFP containing reporter plasmid expressing it under the control of the OxyR/H2O2 inducible pKatG promoterDepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pOxyS-RBS- sfGFP
Plasmid#190052PurposeGFP containing reporter plasmid expressing it under the control of the OxyR/H2O2 inducible pOxyS promoterDepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
p2T-CAG-MCS-P2A-GFP-PuroR
Plasmid#107186PurposeBase plasmid for cloning gene duplication alleles with eGFP reporter.DepositorTypeEmpty backboneAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
PCR4-Hsp68::mCherry-SI-Hsp68::eGFP-H11
Plasmid#211942Purposedual-enSERT-2.2 vector for site-specific integration of.a two-color enhancer-reporter construct into the H11 locus (separated by a synthetic insulator)DepositorTypeEmpty backboneUseCRISPR and Mouse TargetingExpressionMammalianPromoterHSP68Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-Akt-FoxO3a-KTR-EGFP
Plasmid#125131PurposeFluorescent reporter for Akt activityDepositorInsertFOXO2 (FOXO3 Human)
TagsEnhanced green fluorescent protein (EGFP)ExpressionMammalianMutationFoxO3A 1-402 amino acidPromoterCAG promoterAvailable SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-dCas9VPPH-T2A-GFP-shP53
Plasmid#102897PurposeEBNA episome plasmid for CAG promoter constitutive expression of dCas9-VP192-P300core-p65-HSF1 followed by T2A-GFP as a reporter. Includes p53 shRNA expression cassette.DepositorInsertdCas9VPPH-T2A-GFP-shP53
UseCRISPRExpressionMammalianMutationD10A, H840APromoterCAGAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-dCas9VPP300-T2A-GFP-shP53
Plasmid#102896PurposeEBNA episome plasmid for CAG promoter constitutive expression of dCas9-VP192-P300core followed by T2A-GFP as a reporter. Includes p53 shRNA expression cassette.DepositorInsertdCas9VPP300-T2A-GFP-shP53
UseCRISPRExpressionMammalianMutationD10A, H840APromoterCAGAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
HD201: pMVP (L3-L2) IRES-eGFP + polyA
Plasmid#121747PurposepMVP L3-L2 entry plasmid, contains IRES2-eGFP+ polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of eGFP reporter from IRES sequence.DepositorInsertIRES2-eGFP + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
Cux1-SE(IRS)-eGFP-PGK-H2BRFP
Plasmid#241866PurposeInner root sheath (IRS)-specific Cux1 epicenter-driven fluorescent reporterDepositorInsertCux1-SE(IRS)-eGFP
UseLentiviralExpressionMammalianAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only