We narrowed to 92,221 results for: lias
-
Plasmid#169627PurposeTier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' Tactb insulator sequence (PhCMV-SEAP-p2A-iRFP670-pA::Tactb-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA::A3-pA).DepositorInsertPCMV-driven expression of SEAP and iRFP and Tactb-modulated PPGK-driven expression of secreted Nluc and mTagBFP2
ExpressionMammalianPromoterPhCMV / PPGKAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2320
Plasmid#169625PurposeTier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 preluded by a 5' spacer sequence (PhCMV-SEAP-p2A-iRFP670-pA::A2-pA::spacer-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA).DepositorInsertPCMV-driven expression of SEAP and iRFP and spacer-modulated PPGK-driven expression of secreted Nluc and mTagBFP2
ExpressionMammalianPromoterPhCMV / PPGKAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2312
Plasmid#169622PurposeTier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' CoTC insulator sequence (PhCMV-SEAP-p2A-iRFP670-pA::A2-pA::CoTC-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA).DepositorInsertPCMV-driven expression of SEAP and iRFP and CoTC-modulated PPGK-driven expression of secreted Nluc and mTagBFP2
ExpressionMammalianPromoterPhCMV / PPGKAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2317
Plasmid#169624PurposeTier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' insulator sequence derived from the pGL3 plasmid (PhCMV-SEAP-p2A-iRFP670-pA::A2-pA::pGL3-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA).DepositorInsertPCMV-driven expression of SEAP and iRFP and pGL3-modulated PPGK-driven expression of secreted Nluc and mTagBFP2
ExpressionMammalianPromoterPhCMV / PPGKAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pODN-H2BC11-TagBFP
Plasmid#183867PurposeRepair template for the C-terminal tagging of H2B histones with mTagBFP in human cells using CRISPR/Cas9.DepositorInsertH2BC11 homology arms with linker-mTagBFP (H2BC11 Human)
UseCRISPR; Donor templateTagslinker-mTagBFPExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
Slc1a3-CreERT2 Targeting Vector
Plasmid#129409PurposeGene targeting vector to knock-in 2A-CreERT2 into the mouse Slc1a3 locus in place of a STOP codonDepositorInsertSlc1a3-2A-CreERT2 Targeting Vector (Slc1a3 Mouse)
UseCre/Lox and Mouse TargetingExpressionMammalianAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
px335 Slc1a3 nickase 2
Plasmid#129411PurposeCas9n (nickase) with sgRNA directed to the terminal exon of mouse Slc1a3 geneDepositorAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458_sgAgo2_Nterm
Plasmid#170920PurposeExpresses spCas9 and sgRNA targeting the N-terminus of Ago2 for N-terminal taggingDepositorAvailable SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458_sgAgo1_Nterm
Plasmid#170921PurposeExpresses spCas9 and sgRNA targeting the N-terminus of Ago1 for N-terminal taggingDepositorAvailable SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV V5-Chpt1
Plasmid#175155PurposeLentiviral expression of V5-tagged mouse Chpt1DepositorAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV Dnajc16-V5
Plasmid#175156PurposeLentiviral expression of mouse Dnajc16-V5DepositorAvailable SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV Cdipt-V5
Plasmid#175144PurposeLentiviral expression of mouse Cdipt-V5DepositorAvailable SinceJan. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR207-MUM2sp-Citrine-ADPG2
Plasmid#170725PurposeGateway (Invitrogen) entry clone (pDONR207) containing the MUM2 (At5g63800) signal peptide (84bp) fused in-frame to the Citrine and the coding sequence of the HG degrading enzyme ADPG2 (At2g41850.1)DepositorInsertARABIDOPSIS DEHISCENCE ZONE POLYGALACTURONASE 2 (PGAZAT Mustard Weed)
UseGateway donor vector / entry cloneTagsCitrine tag (714bp)Available SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR207-MUM2sp-ADPG2
Plasmid#170723PurposeGateway (Invitrogen) entry clone (pDONR207) containing the MUM2 (At5g63800) signal peptide (84bp) fused in-frame to the coding sequence of the HG degrading enzyme ADPG2 (At2g41850.1)DepositorInsertARABIDOPSIS DEHISCENCE ZONE POLYGALACTURONASE 2 (PGAZAT Mustard Weed)
UseGateway donor vector / entry cloneAvailable SinceNov. 11, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
XLone-Puro Cas13d-eGFP U6 RUNX1 g2
Plasmid#155186PurposePiggybacTransposon-based tunable and temporal expression control of Cas13d- eGFP and RUNX1 gRNA2DepositorInsertCas13d RUNX1 gRNA2
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
XLone-Puro Cas13d-eGFP U6 SOX17 g1
Plasmid#155187PurposePiggybacTransposon-based tunable and temporal expression control of Cas13d- eGFP and SOX17 gRNA1DepositorInsertCas13d SOX17 gRNA1
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV_RBMX-eA3A-UdgX-HF-NG-nCas9
Plasmid#163550PurposeMammalian CG-to-GC base editingDepositorInsertRBMX-eA3A-UdgX-HF-NG-nCas9
UseCRISPRExpressionMammalianMutationnCas9 (D10A)N497A, R661A, Q695A, Q926A//L111R, D1…Available SinceDec. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xhyb PylT A41AA C55A LaG17-SynNotch 204TAA 442TAG
Plasmid#154778Purposeplasmid with 4xhybrid PylT cassette (mutant A41AA C55A) and LaG17-SynNotch 204TAA 277TAG, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertLaG17-SynNotch
TagsLaG17ExpressionMammalianMutation204TAA 442TAG in LaG17-SynNotch, hybrid PylT with…PromoterEF1Available SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
FUG-T2A-F241S
Plasmid#140740PurposeLentiviral vector to overexpress the autism-associated PTEN mutation F241S and GFP as two separate proteinsDepositorInsertGFP-T2A-PTENF241S (PTEN Human)
UseLentiviralTagsnoneExpressionMammalianMutationF241SPromoterhUbiCAvailable SinceMay 4, 2020AvailabilityAcademic Institutions and Nonprofits only