We narrowed to 27,649 results for: CAT
-
Plasmid#184916PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_mic recombines in vivo with a PCR product from pEasyG2_zeo/nat/hph.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMC234r-ccdB/TPK2
Plasmid#176179Purposeyeast MoClo level-0 part plasmid type 234r containing toxic gene dropout cassette (ccdB and TPK2)DepositorInsertdropout cassette containing toxic genes ccdB and TPK2
UseSynthetic BiologyAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
SNX10-PX (1-201)
Plasmid#119091PurposeBacterial expression of human phox homology (PX) domain, SNX10-PX (1-201)DepositorAvailable SinceMay 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSPneogRNA241510+MT
Plasmid#84292PurposeExpress LdPBK_241510.1 and LdMT targeting gRNAs simutaneouslyDepositorInsertLdBPK_241510.1 targeting gRNA and LdMT targeting gRNA
UseCRISPR; Leishmania donovaniPromoterL. donovani ribosome RNA promoterAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
p-EGFP-C1-Flag-mFmr1(A)
Plasmid#87913PurposeExpresses mouse FMRP-EGFP fusion with S499A to prevent phosphorylation.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-FIH1
Plasmid#21403DepositorAvailable SinceSept. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Flag HBx (G124L, I127A)
Plasmid#42598DepositorInsertHepatitis B virus protein X (G124L, I127A)
TagsFlagExpressionMammalianMutationG124L I127AAvailable SinceMarch 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBX_RPL7a_smRuby2_HA
Plasmid#236087PurposeConstitutively encodes RPL7a-smRuby2-HA (mRuby2-based spaghetti monster fluorescent protein embedding HA epitope tags), for targeting the 60S subunit.DepositorInsertRPL7a-smRuby2-HA (RPL7A Synthetic, Human)
ExpressionMammalianAvailable SinceApril 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPBC-G6s
Plasmid#62812PurposepPBC-G6s expresses PiggyBac inverted terminal repeat-flanked GCaMP6s under the control of the CAG promoter.DepositorInsertITR-CAG-GCaMP6s-ITR
ExpressionBacterial and MammalianPromoterCAGAvailable SinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ Zf GFP-vclb
Plasmid#185411PurposeGFP tagged form of zebrafish vinculin b. For in vitro transcription (SP6) or expression through CMVDepositorAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-KG-Itch/2793
Plasmid#11434DepositorAvailable SinceApril 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
NSP6-FR-2Strep
Plasmid#210317PurposeExpresses SARS-CoV-2 NSP6 in mammalian cellsDepositorInsertSARS-CoV-2 NSP6 (ORF1ab SARS-CoV-2 isolate Wuhan-Hu-1)
Tags2StrepExpressionMammalianMutationMany synonymous changes due to codon optimizationAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX-gp78c/2767
Plasmid#11429DepositorAvailable SinceJuly 19, 2006AvailabilityAcademic Institutions and Nonprofits only -
pRN3P-HA-Suv4-20h1
Plasmid#86689PurposeFor transcription of of Suv4-20h1 mRNA preceded by an HA-tag in 5'DepositorAvailable SinceJune 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
"AND-gate" receiver plasmid
Plasmid#127676PurposeEncodes the transcriptional activator LuxR and GFP. LuxR has an pLlacO-1 promoter and the GFP has a pLux promoter.DepositorInsertLuxR, GFP
UseSynthetic BiologyExpressionBacterialPromoterpLlacO-1 for LuxR, pLux for GFPAvailable SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
p-EGFP-C1-Flag-mFmr1(D)
Plasmid#87914PurposeExpresses mouse FMRP-EGFP fusion with phosphorylation mimic S499D.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-CUL1 Y42A/M43A
Plasmid#19940DepositorInsertcullin 1 Y42A/M43A (CUL1 Human)
TagsHA2ExpressionMammalianMutationCUL1 with a SKP1 binding mutantAvailable SinceMay 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ Zf GFP-vcla
Plasmid#185410PurposeGFP tagged form of zebrafish vinculin a. For in vitro transcription (SP6) or expression through CMVDepositorAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
IDE-2Strep
Plasmid#210355PurposeExpresses IDE fused with 2Strep in mammalian cellsDepositorAvailable SinceDec. 19, 2023AvailabilityAcademic Institutions and Nonprofits only