We narrowed to 15,009 results for: GRN
-
Plasmid#241839PurposeCas9-gRNA construct targeting the UBE3A locusDepositorAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 Neo sgNon-targeting
Plasmid#233244PurposeKnock out - non targeting controlDepositorInsertnon targeting control sgRNA
UseLentiviralAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSJ105
Plasmid#208859PurposeExpresses SoxS activation domain and gRNA targeting 105 region within the synthetic promoter in bacterial cellDepositorInsertsgRNA 105
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterCRISPR/dCas9-responsive synthetic promoterAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRRv2_sgTom
Plasmid#218346PurposeCRISPR KO plasmid for tdTomato in human cell linesDepositorInsertInserted sgRNA targeting tdTomato
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
GEARBOCS-Vamp2-GeneTRAP
Plasmid#218187PurposeTo KO and genetrap mouse Vamp2 simultaneouslyDepositorInsertsgRNA (Vamp2 Mouse)
UseAAV and CRISPRAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
GEARBOCS-Vamp2-Tag-HA
Plasmid#218188PurposeTo tag endogenous mouse VAMP2 with HADepositorInsertsgRNA (Vamp2 Mouse)
UseAAV and CRISPRAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCFD3-dUG-D01
Plasmid#138962PurposeUsed in the editing of Drosophila kkvDepositorArticleInsertD01 oligo
UseCRISPR; To synthesize grnaAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pORE303N_CEN1
Plasmid#194439PurposeCRISPR, Cas9 driven by double 35S, nptII for plant selection, knockout CEN1DepositorInsertgRNA targeting CEN1
UseCRISPRExpressionPlantPromoterMtU6Available SinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJJF144_SECGFP_sg2
Plasmid#163865PurposesgRNA targeting GFP in C. elegans. Backbone: pJJR50.DepositorInsertsgRNA targeting GFP
UseCRISPRExpressionWormPromoterR07E5.16 (U6)Available SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJJF143_SECGFP_sg1
Plasmid#163864PurposesgRNA targeting GFP in C. elegans. Backbone: pJJR50.DepositorInsertsgRNA targeting GFP
UseCRISPRExpressionWormPromoterR07E5.16 (U6)Available SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCas9n-Nanog-L
Plasmid#122302PurposeExpresses sgRNA targeting mouse Nanog and Cas9 nickase in mammalian cellsDepositorInsertsgRNA for mouse Nanog (Nanog Synthetic)
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLY131
Plasmid#130956PurposeEngineered sgRNA-LEB2 generator including Anderson promoter J23100 for golden gate assemblyDepositorInsertsgRNA-LEB2
UseSynthetic BiologyExpressionBacterialPromoterAnderson promoter J23100Available SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY74
Plasmid#130945PurposeEngineered sgRNA-G6 (2 BoxB aptamers) generator circuit including promoter Plux2DepositorInsertsgRNA-G6
UseSynthetic BiologyExpressionBacterialPromoterPlux2Available SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-