We narrowed to 11,984 results for: SOM
-
Plasmid#53073Purposedestination vector with ECFP- endosome marker (RabF2a) for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only
-
SLC30A10-delta105-107
Plasmid#65205PurposeConstitutive expression of SLC30A10 delta 105-107 in mammalian cellsDepositorInsertSLC30A10 (SLC30A10 Human)
TagsFlagExpressionMammalianMutationdelta 105-107 amino acidsPromoterCMVAvailable SinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
NC1 pGLUE WTX (1-804)
Plasmid#36956DepositorAvailable SinceJuly 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH742-CEN-RLuc/slowminCFLuc
Plasmid#38222DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Lyso-ExRai-CKAR2
Plasmid#236100PurposeEnhanced excitation-ratiometric biosensor for monitoring Protein Kinase C activity in living cells, targeted to lysosome surface.DepositorInsertLAMP1-ExRai-CKAR2 (LAMP1 Human, Synthetic)
TagsFull-length LAMP1ExpressionMammalianPromoterCMVAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA355_sgCiCh2-2
Plasmid#229021PurposeExpression of a CRISPRi doxycycline inducible control sgRNA that cuts an intergenic region on chromosome 2DepositorInsertsgChr2-2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pINQ-ON10
Plasmid#198689PurposePeriplasmic expression of anti-SARS-Cov-2 Nucleocapsid nanobody ON10 (HA-tagged) in BL21(DE3)DepositorInsertanti-SARS-CoV-2 Nucleocapsid nanobody ON10
Tags6xHis tag, HA tag, OmpA signal peptide, and Ribos…ExpressionBacterialPromoterT7 promoterAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pINQ-NbH4
Plasmid#198690PurposePeriplasmic expression of anti-SARS-Cov-2 Nucleocapsid nanobody H4 (AviTag) in BL21(DE3)DepositorInsertanti-SARS-CoV-2 Nucleocapsid nanobody H4
Tags6xHis tag, Avitag, OmpA signal peptide, and Ribos…ExpressionBacterialPromoterT7 promoterAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
PMP34-mApple-NFAST(low)
Plasmid#214418PurposePeroxisome localization of low-affinity NFAST fused to PMP34-AppleDepositorAvailable SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFSynW SYT9 D197, 199, 330, 332N IRES GFP
Plasmid#195703PurposeLentiviral plasmid encoding SYT9 with D197, 199, 330, 332N mutations followed by an internal ribosomal entry site followed by EGFP under the human synapsin promoterDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWZ157
Plasmid#163639Purposepcn-1>PCN-1::GFP expression plasmid for CRISPR/Cas9 integration at ttTi4348 site on chromosome IDepositorAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pWZ186
Plasmid#163641Purposerps-27>DHB::2xmKate2 expression plasmid for CRISPR/Cas9 integration at ttTi4348 site on chromosome IDepositorInsertDHB:2xmKate2::3xHA
UseCRISPRTags2xmKate2ExpressionWormPromoterrps-27Available SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td1
Plasmid#176257PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 1DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a-Nlux_crRNA NR2
Plasmid#176245PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 2DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_crRNA NR2
Plasmid#176248PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence without Nlux tag and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 2DepositorInserthumanized fnCas12a
UseCRISPR and Synthetic Biology; Expression in micro…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_crRNA NR1
Plasmid#176247PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence without Nlux tag and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 1DepositorInserthumanized fnCas12a
UseCRISPR and Synthetic Biology; Expression in micro…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a-Nlux_crRNA NR3
Plasmid#176246PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 3DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5-FRT-TO-KIF1A(1-365)-VVDfast-mVenus-SSPB(micro)_P2A_iLID-mCherry-RAB11
Plasmid#174646PurposeOptogenetic coupling of RAB11 to opto-kinesin to induce anterograde transport of recycling endosomes. Compatible with Flp-in TREX system.DepositorInsertKIF1A(1-365)-VVDfast-mVenus-SSPB(micro)-P2A-iLID-mCherry-RAB11
ExpressionMammalianMutationmmKIF1A(aa1-365): Pro202Ala; mVenus: Met1Del, Thr…PromoterCMV (with TetOn)Available SinceNov. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_crRNA NR3
Plasmid#176249PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence without Nlux tag and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 3DepositorInserthumanized fnCas12a
UseCRISPR and Synthetic Biology; Expression in micro…Available SinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only