We narrowed to 14,068 results for: crispr grnas
-
Plasmid#223163Purpose2nd gen. AAV backbone for dSaCas9 (endonuclease dead Cas9 from Staphylococcus aureus) and Sa-gRNA ScaffoldDepositorTypeEmpty backboneUseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)Available SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pLenti-Cas9-NS-A
Plasmid#207823PurposeDual expression of Cas9 and non-specific sgRNADepositorInsertnon-specific sgRNA
UseCRISPR and LentiviralTagsFLAGPromoterEF-1a; U6Available SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cas9-NS-B
Plasmid#207824PurposeDual expression of Cas9 and non-specific sgRNADepositorInsertnon-specific sgRNA
UseCRISPR and LentiviralTagsFLAGPromoterEF-1a; U6Available SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA28-pMa-PspCas13b crRNA-TS1
Plasmid#199459PurposeU6-driven crRNA targeting TS1 sequence (CCTCCTCGGAGAGCATCGGTGC )DepositorInsertTS1 crRNA
UseCRISPRPromotermouse U6Available SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pROS13_IDH2 #7
Plasmid#166102PurposeThis plasmid express a sgRNA that targets the IDH2 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH2-135 by homologous recombination.DepositorArticleAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pROS13_IDH1 #4
Plasmid#166101PurposeThis plasmid express a sgRNA that targets the IDH1 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH1-67 by homologous recombination.DepositorArticleAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 AtU6-26:AsCas12a_DR (GB1442)
Plasmid#160574PurposeAsCas12a direct repeat sequence fused to the A. thaliana U6-26 promoter used for the assembly of gRNA expression cassettes.DepositorInsertAtU6-26:AsCas12a_DR
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pICSL11062
Plasmid#68256PurposeLevel 1 Golden Gate Cassette: sgRNA cassette targeting BolC.GA4a-2 in Brassica oleraceaDepositorInsertPromoter_AtU6-26 + sgRNA_BolC.GA4a-2
UseSynthetic BiologyExpressionPlantAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX459-gR2A_Hinge
Plasmid#124811PurposeVector for expression Cas9 with gRNA specific for rat IgG2a heavy chain locus. Use in combination with pHybr_r2a>Fab-srt-his plasmids to convert expression of hybridomas to Fab' fragments.DepositorInsertCas9 – gRNA_R2A_hinge
UseCRISPRTags3XFLAG and GFPExpressionBacterial and MammalianMutationR166H in PuroR (please see depositors comment bel…PromoterpUCAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJW1849
Plasmid#154327PurposesgRNA Target Vector for CRISPRDepositorInsertttTi4348 site targeting sgRNA (F+E) with K09B11.2 U6 promoter and 3'UTR
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJW1883
Plasmid#154331PurposesgRNA Target Vector for CRISPRDepositorInsertttTi5605 site targeting sgRNA (F+E) with R07E5.16 U6 promoter and 3'UTR
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJW1850
Plasmid#154328PurposesgRNA Target Vector for CRISPRDepositorInsertttTi5605 site targeting sgRNA (F+E) with K09B11.2 U6 promoter and 3'UTR
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJW1882
Plasmid#154330PurposesgRNA Target Vector for CRISPRDepositorInsertttTi4348 site targeting sgRNA (F+E) with R07E5.16 U6 promoter and 3'UTR
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJW1851
Plasmid#154329PurposesgRNA Target Vector for CRISPRDepositorInsertcxTi10882 site targeting sgRNA (F+E) with K09B11.2 U6 promoter and 3'UTR
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJW1884
Plasmid#154332PurposesgRNA Target Vector for CRISPRDepositorInsertcxTi10882 site targeting sgRNA (F+E) with R07E5.16 U6 promoter and 3'UTR
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSJX022
Plasmid#232325PurposeGenome editing in Caulobacter crescentusDepositorInsertssgRNA
SpCas9M
UseCRISPRTagsH-arms and catExpressionBacterialPromoterPJ23119 and PvanAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSJX023
Plasmid#232326PurposeGenome editing in Caulobacter crescentusDepositorInsertssgRNA
SpCas9M
UseCRISPRTagsH-arms and sfGFPExpressionBacterialPromoterPJ23119 and PxylAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSJX024
Plasmid#232327PurposeGenome editing in Caulobacter crescentusDepositorInsertssgRNA
SpCas9M
UseCRISPRTagsH-arms and catExpressionBacterialPromoterPJ23119 and PxylAvailable SinceJune 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSJX016
Plasmid#232324PurposeGenome editing in Caulobacter crescentusDepositorInsertssgRNA
SpCas9M
UseCRISPRTagsH-arms and sfGFPExpressionBacterialPromoterPJ23119 and PvanAvailable SinceJune 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSJX067
Plasmid#232328PurposeGenome editing in Agrobacterium fabrumDepositorInsertssgRNA
SpCas9M
UseCRISPRTagsH-arms and sfGFPExpressionBacterialPromoterPJ23119 and PvanAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only