We narrowed to 11,984 results for: SOM
-
Plasmid#89890PurposeBAC donor construct containing 3XHA-tagged BirA, a ribosome skipping motif - 2A, Citrine reporter, polyadenyation signal, followed by FRT recombination sites flanking kanamycin selection cassette.DepositorInsertHA-BirA-2A-citrine
UseUnspecifiedTagsCitrineAvailable SinceAug. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFB-EF1a-DIO-Rpl22l1-myc-Flag-2A-tdTomato-WPRE-hGHpA
Plasmid#246243PurposeCre dependent flag-tagged Rpl22l1.DepositorInsertRpl22l1 (Rpl22l1 Mouse)
UseAAVTagsMyc-FLAG-T2A-tdTomatoExpressionMammalianPromoterEF1aAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-VIM270-pSM
Plasmid#215871PurposeThis plasmid encodes luciferaase which has siRNA binding sites in 3'UTR for detecting the knockdown efficiency of siRNA.DepositorInsert3 tandem repeats of target site (complementary to seed seq of passenger strand of siRNA for VIM) is inserted to 3'UTR of RLuc (VIM Human)
ExpressionMammalianAvailable SinceMay 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-VIM270-pCM
Plasmid#215869PurposeThis plasmid encodes luciferaase which has siRNA binding sites in 3'UTR for detecting the knockdown efficiency of siRNA.DepositorInserttarget site which is completely complementary to passanger strand of siRNA for vimentin is inserted to 3'UTR of RLuc (VIM Human)
ExpressionMammalianAvailable SinceMay 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
LifeAct-mNeonGreen -IRES- Talin head-SpyTag003
Plasmid#210024PurposeExpression of LifeAct-mNeonGreen and Talin head(1-433)-SpyTag003 in mammalian cellsDepositorInsertLifeAct-mNeonGreen co-expressed with Talin head(1-433)-SpyTag003
ExpressionMammalianMutationEncephalomyocarditis virus internal ribosome entr…PromoterCMVAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td2
Plasmid#176258PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a_crRNA Td2
Plasmid#176255PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationD917A and E1006A mutations to inactivate the endo…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2_Bod1l_Anti-Sense
Plasmid#124444PurposePlasmid for anti-sense in situ probe in vitro transcriptionDepositorInsertBiorientation of chromosomes in cell division 1-like (Bod1l Mouse)
UseIn situ probePromoterT7Available SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTH731-2µ-RLuc/minCFLuc
Plasmid#40601DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
PB-GFP-Gal8
Plasmid#127191PurposePiggybac transposon plasmid with CAG promoter GFP-Galectin 8 (GFP-Gal8) fusion protein. Useful as genetically encoded endosomal escape sensor.DepositorInsertGFP-Gal8 (LGALS8 Human)
TagsGal8 is fused to the c-terminus of GFPExpressionMammalianPromoterCMVAvailable SinceDec. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
IronFistMUT.
Plasmid#243008PurposeIron binding deficient IronFistDepositorInsertsUseGatewayTagsmNeonGreenExpressionMammalianMutationH15A, H57A, E58A, E61A, H126A, E130APromoterhuman phosphoglycerate kinase (hPGK)Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-Myo10
Plasmid#135403PurposeExpresses GFP-tagged bovine Myo10 in mammalian cells.DepositorInsertMyo10 (MYO10 Bovine)
TagsEGFPExpressionMammalianMutation"Relative to the GenBank Myo10 cDNA sequence…PromoterCMVAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
EF1a_Puro_Telo_v2
Plasmid#195139Purpose~100 repeats of the human telomere seed sequence fused to the puromycin resistance gene; digest with BstZ17I-HF and KpnI-HF to obtain transfectable construct for chromosomal arm loss inductionDepositorInsertTelomere (RTEL1 Human)
ExpressionMammalianAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
EF1a_Puro_Telo_v1
Plasmid#195138Purpose~100 repeats of the human telomere seed sequence fused to the puromycin resistance gene; digest with BstZ17I-HF and KpnI-HF to obtain transfectable construct for chromosomal arm loss inductionDepositorInsertTelomere (RTEL1 Human)
ExpressionMammalianAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGM238
Plasmid#220178PurposeExpresses exogenous ribosomal-binding domain mutant NAC complex members (K78E NACA and K43E BTF3)DepositorUseLentiviralTags3xFLAG (NACA); 6xHis (BTF3)MutationK78E (NACA) + K43B (BTF3)Available SinceJune 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a-KRAB_crRNA NC
Plasmid#176262PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged to the KRAB domain and Nlux and spacer sequence is replaced by the type IIS restriction site for endonucleasDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsKruppel associated box domain and luciferaseMutationD917A and E1006A mutations to inactivate the endo…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9-KRAB_sgRNA Td2
Plasmid#176264PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged to the KRAB domain and Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsKruppel associated box domain and luciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRI003-pGEM-LS-Bar-PgpdA-dSpCas9-VPR-TtrpC-LS
Plasmid#140196PurposeChromosomal integration of PgpdA-dSpCas9-VPR-TtrpC. Contains 1kb homology arms for Aspergillus nidulans and the bar gene for glufosinate selection. Filamentous fungi vector.DepositorInsertsdSpCas9-VPR
Bar
Homology arm (ChrIV_A_nidulans_FGSC_A4:2736011,2737053)
Homology arm (ChrIV_A_nidulans_FGSC_A4:2790295,2791327)
UseCRISPR and Synthetic Biology; Fungal genome integ…TagsVPR (VP64-p65-Rta) , NLSPromoterPgpdA and PtrpCAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRI005-pYFAC-riboB-PgpdA-dLbCpf1(D156R)-VPR-TtrpC
Plasmid#140198PurposeEpisomal expression of dLbCpf1(D156R)-VPR, variant for culture at room temperature. Filamentous fungi vector with AMA1 and riboB selection marker.DepositorInsertdLbCas12a(D156R)-VPR
UseCRISPR and Synthetic Biology; Expression in asper…TagsVPR (VP64-p65-Rta), NLSMutationD832A DNase deactivated, D156R for improved activ…PromoterPgpdAAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only