We narrowed to 28,969 results for: Tat
-
Plasmid#163329PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the human PGK promoter.DepositorAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pCJ220
Plasmid#162686PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating lid deletion (Gly251:Thr472) and C224W and C529S mutations from PETase active site.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1) with lid deletion and C224W and C529S mutations
TagsHisExpressionBacterialMutationdeltaG251-T472, C224W, C529S; codon optimized for…PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCJ221
Plasmid#162687PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating lid deletion (Gly251:Thr472) and C224H and C529F mutations from PETase active site.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), with lid deletion and C224H and C529F mutations
TagsHisExpressionBacterialMutationdeltaG251-T472, C224H, C529F; codon optimized for…PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
BPV00914 pET21GG2 H6-TF-BECN (1-450) [VA-MA-LA]
Plasmid#136688PurposeExpresses the full-length Beclin-1 protein (a.a. 1-450) with a N-terminal hexa-Histidine and solubility tag (i.e., Trigger Factor). Three mutations are added to the CC and ECD/BARA interface.DepositorInsertBeclin-1 (BECN1 Human)
TagsTrigger FactorExpressionBacterialMutationDNA optimized for E. coli expression w/ three mut…PromoterT7Available SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
RALA V25L
Plasmid#122927PurposeBacterial expression of RALA V25LDepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
RALA V25M
Plasmid#122928PurposeBacterial expression of RALA V25MDepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
RALA D130G
Plasmid#122929PurposeBacterial expression of RALA D130GDepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
RALA S157A
Plasmid#122930PurposeBacterial expression of RALA S157ADepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
RALA R176X
Plasmid#122931PurposeBacterial expression of RALA R176XDepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
RALA WT
Plasmid#122925PurposeBacterial expression of RALA WTDepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
RALA G23D
Plasmid#122926PurposeBacterial expression of RALA G23DDepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
mTet1 flox donor
Plasmid#117147PurposeMaking Tet1 conditional knock outDepositorArticleInsertTet1 (Tet1 Mouse)
UseMouse TargetingAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
mTet3 flox donor
Plasmid#117146PurposeMaking Tet3 conditional knock outDepositorArticleInsertTet3 (Tet3 Mouse)
UseMouse TargetingAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLgw EcoDam-V5-ELK4
Plasmid#98606PurposeMammalian DamID lentiviral vector for ELK4 with Dam-V5 using Gateway cloningDepositorInsertELK4 (Elk4 Mouse)
UseLentiviral; DamidTagsDam (DNA adenine methyltransferase) and V5ExpressionMammalianPromoterHeat Shock Minimal PromoterAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mM-Asp212Ser_M18
Plasmid#91739PurposeExpression plasmid coding for mutated heavy chain of mouse IgM antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Asp212Ser (EU numbering) - N-glycosylated Asn209DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationAsp212 changed to Ser (EU numbering)PromoterhEF1-HTLV promAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_RBM34_WT_V5
Plasmid#82998PurposeGateway Donor vector containing RBM34, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_CBR3_WT_V5
Plasmid#83015PurposeGateway Donor vector containing CBR3, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_ACAT2_WT_V5
Plasmid#82996PurposeGateway Donor vector containing ACAT2, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_NPDC1_WT_V5
Plasmid#82980PurposeGateway Donor vector containing NPDC1, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only