We narrowed to 4,689 results for: crispr c plasmids
-
Plasmid#192253Purposeexpressing sgRNA-1 targeting eIF3f locus closed to stop codenDepositorInsertsgRNA-1 targeting eIF3f locus closed to stop coden (EIF3F Human)
UseCRISPRExpressionMammalianAvailable SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
eIF3f sgRNA-2 PX459 plasmid
Plasmid#192254Purposeexpressing sgRNA-2 targeting eIF3f locus closed to stop codenDepositorInsertsgRNA-2 targeting eIF3f locus closed to stop coden (EIF3F Human)
UseCRISPRExpressionMammalianAvailable SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
eIF3b sgRNA-2 PX459 plasmid
Plasmid#192250Purposeexpressing sgRNA-2 targeting eIF3b locus closed to stop codenDepositorInsertsgRNA-2 targeting eIF3b locus closed to stop coden (EIF3B Human)
UseCRISPRExpressionMammalianAvailable SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
eIF3b sgRNA-1 PX459 plasmid
Plasmid#192249Purposeexpressing sgRNA-1 targeting eIF3b locus closed to stop codenDepositorInsertsgRNA-1 targeting eIF3b locus closed to stop coden (EIF3B Human)
UseCRISPRExpressionMammalianAvailable SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-CBE C-terminal
Plasmid#137176PurposeAAV genome: expresses the C-terminal of v5 AAV-CBE from the Cbh promoter, and U6-sgRNADepositorInsertv5 AAV-CBE C-terminal; U6-protospacer
UseAAVPromoterCbhAvailable SinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-ABE C-terminal
Plasmid#137178PurposeAAV genome: expresses the C-terminal of v5 AAV-ABE from the Cbh promoter, and U6-sgRNADepositorInsertv5 AAV-CBE C-terminal; U6-protospacer
UseAAVPromoterCMVAvailable SinceJan. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
GEARBOCS-SPARCL1-C-mCherryTag
Plasmid#218183PurposeTo tag Hevin with mCherry at its C-terminalDepositorInsertsgRNA (Sparcl1 Mouse)
UseAAV and CRISPRAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.luxR(mut)-sggfp(C)
Plasmid#236043PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(C) expresses the dCas12a endonuclease and the sgRNA (design C) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (C) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
LMX1B-gRNA-C-del
Plasmid#131516PurposegRNA to delete a nucleation site near Lmx1b. Use with LMX1B-gRNA-N-delDepositorInsertLMX1B-gRNA-C-del
UseCRISPRExpressionMammalianAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
SKOR1-gRNA-C-del
Plasmid#131332PurposegRNA to delete a nucleation site near Skor1. Use with SKOR1-gRNA-N-delDepositorInsertSKOR1-gRNA-C-del
UseCRISPRExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
TS-PE2-C-WPRE
Plasmid#176650PurposeExpresses C-terminus of PE2 in mammalian cellsDepositorInsertsC-terminus of PE2
Artificial SA
WPRE
bGH poly(A)
UseAAVTagsSV40 NLSExpressionMammalianPromoterNoneAvailable SinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSAVED-CHAT_PCaspase-C-term
Plasmid#214045PurposeBacterial expression plasmid for SAVED-CHAT and PCaspase C-terminal fragment (aa 154-666) from Haliangium ochraceumDepositorInsertSAVED-CHAT-PCaspase
ExpressionBacterialMutationaa 154-666PromoterlacUV5 promoterAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-pCbh-SpRY[C-term]-gRNAentry (CA20)
Plasmid#197511PurposeCbh promoter expression plasmid for C-terminal intein-split AAV construct with C-term of SpRY and BsmBI entry cassette to clone SpCas9 gRNA spacerDepositorInsertAAV-[ITR]-pCbh-BPNLS-NpuC-SpRY[C-term]-BPNLS-gRNA[BsmBI]-pU6-[ITR]
UseAAV and CRISPRTagsBPNLS and BPNLS-NpuC(intein)MutationC-terminal mutations of SpRY(L1111R/D1135L/S1136W…PromoterCbhAvailable SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBR25 IFT70 [A331R, A335R] crSpecR (C. reinhardtii)
Plasmid#238230PurposeCRISPR donor plasmid for C-terminal knock-in of IFT70 [A331R, A335R] and insertion of Spectinomycin resistance (C. reinhardtii)DepositorInsertIFT70 [A331R, A335R]
UseCRISPR; DonorTagsNoneAvailable SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
C-Terminal Split Cas9 with GyrA intein
Plasmid#58694PurposeExpresses truncated C-terminal SpCas9 domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with N-Terminal Split Cas9 Gyra Intein for full length SpCas9 productionDepositorInsertHumanized C-Terminal S. pyogenes Cas9 with GyrA Csplit Intein
UseAAV and CRISPRTagsGyrA Csplit Intein and NLSExpressionMammalianPromoterCBhAvailable SinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-C-intein-C-spC9-H840A-N863A-2xNLS-hGH
Plasmid#112211PurposeTargeted DNA methylationDepositorInsertC-terminus of dCas9
UseAAVMutationD10AAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
C-term AAV-SpCas9-VRQR-gRNA_entry (HES1477)
Plasmid#242660PurposeCBh promoter expression plasmid for C-terminal intein-split AAV construct with C-term of SpCas9-VRQR and pU6 SpCas9 gRNA entry cassetteDepositorInsertpAAV-pCbh-BPNLS-NpuC-SpCas9-VRQR-BPNLS-WPRE-bGH_PA-SpCas9_gRNA_entrycassette
UseAAV and CRISPRTagsBPNLSMutationVRQR mutations in SpCas9(S55R/D1135V/G1218R/R1335…PromoterCBhAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-PE2-C
Plasmid#164908PurposeExpresses the C-terminal split-intein fragment of PE2DepositorInsertPE2-C
UseAAVAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV8-cPE-C
Plasmid#183539PurposeDeliver a split compact Prime Editor in vivoDepositorInsertC-terminal fragment of SpCas9 nickase (H840A), Reverse Transcriptase
UseAAVExpressionMammalianPromoterU1AAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
PE_CO-Mini-C
Plasmid#190337PurposeExpressing the C-terminal of PE_CO-Mini using Rma intein and Cas9 673-674 split site, and pegRNA for PCSK9 +1A insertionDepositorInsertPE_CO-Mini-C, PCSK9 +1A insertion pegRNA
UseAAVAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV Intein-C-SpyCas9, CMV-AcrIIA4-scaffold (2xBsmBI sites)
Plasmid#120294PurposeAAV Vector for expression of C-terminal SpyCas9 fragemnt with split-intein and a CMV-driven AcrIIA4 (no miR binding sites)DepositorInsertC-terminal fragment of SpyCas9
UseAAV and CRISPRTagssplit-inteinExpressionMammalianAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZNF589-donor
Plasmid#112340PurposeCRISPR donor plasmid to tag human transcription factor ZNF589 with GFPDepositorInsertZNF589 homology arms flanking EGFP-IRES-Neo cassette (ZNF589 Human)
UseCRISPRMutationhg38:3:48267877:T>C, hg38:3:48267890:C>T, h…Available SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBR25 CFAP36-3C-mStayGold-2Strep crBSDr (C. reinhardtii)
Plasmid#238226PurposeCRISPR donor plasmid for C-terminal tagging of CFAP36 and insertion of Blasticidin resistance (C. reinhardtii)DepositorInsertCFAP36
UseCRISPR; DonorTags-3C-mStayGold-2StrepAvailable SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZNF445-donor
Plasmid#112332PurposeCRISPR donor plasmid to tag human transcription factor ZNF445 with GFPDepositorInsertZNF445 homology arms flanking EGFP-IRES-Neo cassette (ZNF445 Human)
UseCRISPRMutationrs78585428, hg38:3:44446218:C>T, hg38:3:444466…Available SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only