We narrowed to 4,936 results for: AAT
-
Plasmid#227451Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 2.1kb Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_2_As
Plasmid#155058PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUDE710
Plasmid#103020Purposeexpression of a Cpf1 programming crRNA targeting ADE2 and HIS4 (crADE2-3 crHIS4-4.S)DepositorAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_3
Plasmid#155075PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-12mer-14kb-USF-1-12
Plasmid#227472Purpose12-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 14kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_2
Plasmid#155070PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_4
Plasmid#155076PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_intergenic-intergenic_1
Plasmid#155077PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsert(hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-intergenic-As
Plasmid#209026PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_1-Lb
Plasmid#209027PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-intergenic-Lb
Plasmid#209030PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_1-As
Plasmid#209031PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_2
Plasmid#155060PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and an intergenic site & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB09-TRE-beta-globin-miR-124-EF1a-GFP
Plasmid#117318PurposeOverexpression of miR-124 in eurkaryotic cells, encoded in a human beta-globin intronDepositorInserthsa-miR-124-1 (MIR124-1 Human)
UseTransposon-mediated integrationTagsGFPExpressionMammalianPromoterTet-inducible promoterAvailable SinceJan. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSMPUW-miR-124-GFP-Puro
Plasmid#117321PurposeOverexpression of miR-124 in eurkaryotic cells, encoded in a human beta-globin intronDepositorInserthsa-miR-124-1 (MIR124-1 Human)
UseLentiviralTagsGFP-PuroExpressionMammalianPromoterEF1aAvailable SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mCherry-intergenic-As
Plasmid#209037PurposeLentiviral vector expressing mCherry along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-Rorb sesRNA-2a-msFlag-2a-tTA2-WPRE
Plasmid#239029PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic-As
Plasmid#209036PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-LRRK2-G2019S-3a
Plasmid#180432PurposeTransiently expressing a pegRNA to introduce LRRK2-G2019S mutation in human cellsDepositorInsertncRNA targeting LRRK2-G2019S (LRRK2 Human)
UseCRISPRExpressionMammalianMutationLRRK2-G2019SPromoterU6Available SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-LRRK2-G2019S-3b
Plasmid#180433PurposeTransiently expressing a pegRNA to introduce LRRK2-G2019S mutation in human cellsDepositorInsertncRNA targeting LRRK2-G2019S (LRRK2 Human)
UseCRISPRExpressionMammalianMutationLRRK2-G2019SPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-LRRK2-G2019S-3c
Plasmid#180434PurposeTransiently expressing a pegRNA to introduce LRRK2-G2019S mutation in human cellsDepositorInsertncRNA targeting LRRK2-G2019S (LRRK2 Human)
UseCRISPRExpressionMammalianMutationLRRK2-G2019SPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-LRRK2-G2019S-3d
Plasmid#180435PurposeTransiently expressing a pegRNA to introduce LRRK2-G2019S mutation in human cellsDepositorInsertncRNA targeting LRRK2-G2019S (LRRK2 Human)
UseCRISPRExpressionMammalianMutationLRRK2-G2019SPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
pLY59
Plasmid#130927PurposeA CRISPR activation device with the necessary genes (dcas9 controlled by Ptet, pspFΔHTH::MCP controlled by promoter J23106), and the reporter part (PpspA-2G6 with sfgfp::ASV).DepositorInsertsdcas9
tetR
sfgfp
pspFΔHTH::MCP
UseSynthetic BiologyTagsASV tag and MCP (MS2 coat protein)ExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterAnderson promoter: J23106, PpspA-2G6, and PtetAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
N379K EPHA3 pcDNA3.1
Plasmid#102745PurposeExpression of EPHA3 in mammalian cellsDepositorInsertEPHA3 (EPHA3 Human)
Tagsmyc-6xhisExpressionMammalianMutationN379K (AAT > AAG)PromoterCMVAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
T166N EPHA3 pcDNA3.1
Plasmid#102742PurposeExpression of EPHA3 in mammalian cellsDepositorInsertEPHA3 (EPHA3 Human)
Tagsmyc-6xhisExpressionMammalianMutationT166N (ACT > AAT)PromoterCMVAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
D806N EPHA3 pcDNA3.1
Plasmid#102754PurposeExpression of EPHA3 in mammalian cellsDepositorInsertEPHA3 (EPHA3 Human)
Tagsmyc-6xhisExpressionMammalianMutationD806N (GAT > aAT)PromoterCMVAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
K761N EPHA3 pcDNA3.1
Plasmid#102752PurposeExpression of EPHA3 in mammalian cellsDepositorInsertEPHA3 (EPHA3 Human)
Tagsmyc-6xhisExpressionMammalianMutationK761N (AAG > AAt)PromoterCMVAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV CAG Barcode6
Plasmid#229068PurposeExpression mappingDepositorInsertCAG Barcode6
UseAAVAvailable SinceDec. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV CAG Barcode3
Plasmid#229064PurposeExpression mappingDepositorInsertCAG Barcode3
UseAAVAvailable SinceDec. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode15
Plasmid#226189PurposeExpression mappingDepositorInsertSyn Barcode15
UseAAVAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode13
Plasmid#226187PurposeExpression mappingDepositorInsertSyn Barcode13
UseAAVAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode21
Plasmid#226194PurposeExpression mappingDepositorInsertSyn Barcode21
UseAAVAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode17
Plasmid#226190PurposeExpression mappingDepositorInsertSyn Barcode17
UseAAVAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode11
Plasmid#226185PurposeExpression mappingDepositorInsertSyn Barcode11
UseAAVAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
LHZ1494
Plasmid#222104PurposeTriple sgRNAs expression plasmid in Kluyveromyces marxianus.DepositorInsertsg1RNA, sg4RNA, sg7RNA
UseCRISPRExpressionYeastAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
Banshee shTCF1 mCherry
Plasmid#80154Purposeexpresses shRNA targeting TCF1 and mCherryDepositorInsertTCF1
UseRetroviralExpressionMammalianAvailable SinceAug. 2, 2016AvailabilityAcademic Institutions and Nonprofits only