We narrowed to 4,562 results for: TIL
-
Plasmid#207991PurposeCRISPR vector used with pAf-CRISPR-ctfR1 (#207992) to delete both aflatoxin and cyclopiazonic acid gene clusters of Aspergillus flavusDepositorInsertphoA
UseCRISPRPromoterAspergillus flavus U6Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOCC240
Plasmid#118895Purposeshuttle vector for baculovirus production, using FlashBac bacmid; for rec. protein with N-terminal MBP tag, cleavable with 3C and C-terminal mCherry, cleavable with TEV and HIS6, cleavable with 3CDepositorInsertNcoI-MBP-3C-NotI-ccdB-AscI-TEV-mCherry-3C-HIS6-stop-HindIII cassette
TagsMBP, cleavable with 3C protease and mCherry, clea…ExpressionInsectPromoterpolHAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTG-mTDG-K341R
Plasmid#52267PurposeBacterial expression of mouse TDG-K341R with C-terminal GST-tagDepositorInsertTDG (Tdg Mouse)
TagsGSTExpressionBacterialMutationK341R, SUMO acceptor site mutationPromoterT7Available SinceJuly 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-β2AR-NNES-NanoLuc-eLOV-TEVcs-Flag-Gal4-V5
Plasmid#125236PurposeExpresses modified SPARK β2AR-NanoLuc transmembrane component in mammalian cellsDepositorInsertβ2AR-NNES-NanoLuc-eLOV-TEVcs-Flag-Gal4-V5
UseAAVTagsFlag, V5ExpressionMammalianPromoterCMVAvailable SinceJune 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFSW Doc2alpha WT
Plasmid#128812PurposeTo make virus expressing Doc2alpha WTDepositorInsertDoc2alpha (Doc2a Rat)
UseLentiviralTagsIRES-EGFPPromoterhSyn (human synapsin I promoter)Available SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFSW Doc2beta WT
Plasmid#128814PurposeTo make virus expressing Doc2beta WTDepositorAvailable SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
KK501: pMVP (L3-L2) FKBP DD + polyA
Plasmid#121789PurposepMVP L3-L2 entry plasmid, contains FKBP DD + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows fusion of C-term FKBP degron domain (stabilized by SHLD1) to gene of interest.DepositorInsertFKBP Degron Domain + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV CreERT2 R4-R3
Plasmid#62173PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a CMV promoter and CreERT2 module. Compatible with MultiSite Gateway cloningDepositorInsertCreERT2
UseMule gateway entry vectorExpressionMammalianPromoterCMVAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-TRAF4
Plasmid#58318PurposeEGFP-tagged mouse TRAF4DepositorAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pOCC175
Plasmid#118890Purposeshuttle vector for baculovirus production, using FlashBac bacmid; for recombinant protein with N-terminal HIS6-MBP tag, cleavable with 3C, and N-terminal monomeric GFP, cleavable with TEVDepositorInsertNcoI-HIS6-MBP-3C-mGFP-TEV-NotI-ccdB-AscI-stop-HindIII cassette
TagsHIS6-MBP, cleavable with 3C protease; mGFP, cleav…ExpressionInsectPromoterpolHAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
LAP2-beta-actin in modified pEGFP
Plasmid#34839DepositorAvailable SinceFeb. 1, 2012AvailabilityAcademic Institutions and Nonprofits only -
KJ901: pMAGIC (R4-R3) NLS-(SrfI/PmeI)-NLS
Plasmid#121835PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS scaffold enabling addition of dCas9 mutants into pMAGIC. dCas9 can be inserted via unique SrfI/PmeI restriction sitesDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOCC120
Plasmid#118892Purposeshuttle vector for baculovirus production, using FlashBac bacmid; for recombinant protein with N-terminal MBP tag, cleavable with 3C, and C-terminal monomeric GFP and HIS6, cleavable with TEVDepositorInsertNcoI-MBP-3C-NotI-ccdB-AscI-mGFP-3C-HIS6-stop-HindIII cassette
TagsMBP, cleavable with 3C protease and mGFP, HIS6, c…ExpressionInsectPromoterpolHAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-POLArISact
Plasmid#164970PurposeT7 promotor drives in vitro transcription of POLArISact with a human kozak sequenceDepositorInsertPOLArISact
UseIn vitro transcriptionPromoterT7Available SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
mEmerald-MyosinIIC-C-18
Plasmid#54194PurposeLocalization: Cytoskeleton, Excitation: 487, Emission: 509DepositorInsertMyosinIIC
TagsmEmeraldExpressionMammalianPromoterCMVAvailable SinceJuly 10, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
IF311: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-LSD1
Plasmid#121824PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the LSD1 H3K4me1/2 demethylase for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/LSD1 (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pH-eCFP
Plasmid#176555PurposeExpression of eCFP for auxotrophic selection in the absence of histidineDepositorInserteCFP
ExpressionYeastPromoterTDH1(GAP)Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pL-eCFP
Plasmid#176556PurposeExpression of eCFP for auxotrophic selection in the absence of leucineDepositorInserteCFP
ExpressionYeastPromoterTDH1(GAP)Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU-eCFP
Plasmid#176557PurposeExpression of eCFP for auxotrophic selection in the absence of uracilDepositorInserteCFP
ExpressionYeastPromoterTDH1(GAP)Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU-mRuby2
Plasmid#176549PurposeExpression of mRuby2 for auxotrophic selection in the absence of uracilDepositorInsertyomRuby2
ExpressionYeastPromoterTDH1(GAP)Available SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pH-mRuby2
Plasmid#176547PurposeExpression of mRuby2 for auxotrophic selection in the absence of histidineDepositorInsertyomRuby2
ExpressionYeastPromoterTDH1(GAP)Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR SV40 CreERT2 L3-L2
Plasmid#62174PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a SV40 promoter and CreERT2 module. Compatible with MultiSite Gateway cloningDepositorInsertCreERT2
UseMule gateway entry vectorExpressionMammalianPromoterSV40Available SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 stuffer sgRNA scaffold R4-R3
Plasmid#62131PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and sgRNA scaffold module for gRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseCRISPR; Mule gateway entry vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV LacZ L5-L2
Plasmid#62166PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a CMV promoter and LacZ module. Compatible with MultiSite Gateway cloningDepositorInsertLacZ
UseMule gateway entry vectorExpressionMammalianPromoterCMVAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
RET_KD-V5
Plasmid#139628PurposeV5-His-tagged gene expressionDepositorAvailable SinceMay 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-mas-KB-1753-Nluc I9A/W10A
Plasmid#158604PurposePlasmid expressing KB-1753-Nluc I9A/W10A in mammalian cellsDepositorInsertmyristic acid attachment peptide (mas; MGSSKSKTSNS) - linker(GIKLGG) - KB1753 I9A/W10A - linker (GGTGGS) - Nluc
ExpressionMammalianPromoterCMVAvailable SinceJune 29, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
JP705: pMVP/SB/Neo-DEST
Plasmid#121866PurposepMVP destination vector, empty Sleeping Beauty transposon vector backbone w/ Neo selection cassetteDepositorTypeEmpty backboneUseSleeping beauty transposon, pmvp gateway destinat…ExpressionMammalianAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-mas-GRK2RH-Nluc L118A
Plasmid#158606PurposePlasmid expressing GRK2(RH)-Nluc L118A in mammalian cellsDepositorInsertmyristic acid attachment peptide (mas; MGSSKSKTSNS) - linker (GIKLGG) - GRK2 RH domain L118A - linker (GGTGGS) - Nluc
ExpressionMammalianPromoterCMVAvailable SinceJune 29, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMuLE ENTR SV40 mCherry L3-L2
Plasmid#62150PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a SV40 promoter and mCherry module. Compatible with MultiSite Gateway cloningDepositorInsertmCherry
UseMule gateway entry vectorExpressionMammalianPromoterSV40Available SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
TetO-FUW-Ngn1
Plasmid#118589PurposeExpresses Ngn1 from the TRE3G promoterDepositorAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
PTPRA_C433S-GFP fusion
Plasmid#139638PurposeGFP-tagged gene expressionDepositorAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
PTPRA_C723S-GFP fusion
Plasmid#139639PurposeGFP-tagged gene expressionDepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 stuffer sgRNA scaffold L1-L4
Plasmid#62128PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and sgRNA scaffold module for gRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseCRISPR; Mule gateway entry vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
KK001: pMVP/SB/Hygro-DEST
Plasmid#121867PurposepMVP destination vector, empty Sleeping Beauty transposon vector backbone w/ Hygro selection cassetteDepositorTypeEmpty backboneUseSleeping beauty transposon, pmvp gateway destinat…ExpressionMammalianAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nelfcd-g1)-PGKpuroBFP-W
Plasmid#105025PurposeLentiviral gRNA plasmid targeting mouse Nelfcd , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nelfcd-g2)-PGKpuroBFP-W
Plasmid#105026PurposeLentiviral gRNA plasmid targeting mouse Nelfcd , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
IX301: pMVP (L3-L2) myc epitope tag + polyA
Plasmid#121753PurposepMVP L3-L2 entry plasmid, contains myc epitope tag + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest.DepositorInsertmyc epitope tag + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR SV40 mCherry L5-L2
Plasmid#62149PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a SV40 promoter and mCherry module. Compatible with MultiSite Gateway cloningDepositorInsertmCherry
UseMule gateway entry vectorExpressionMammalianPromoterSV40Available SinceFeb. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
IX601: pMVP (L3-L2) FLAG epitope tag + polyA
Plasmid#121751PurposepMVP L3-L2 entry plasmid, contains FLAG epitope tag + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest.DepositorInsertFLAG epitope tag + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMuLE Lenti Dest IFP1.4
Plasmid#62177PurposeMuLE (Multiple Lentiviral Expression) Destination vector for use with pMuLE Entry vectors. Co-expresses IFP1.4 under the control of a PGK promoter. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseLentiviral; Mule gateway destination vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 stuffer sgRNA scaffold L1-R5
Plasmid#62127PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and sgRNA scaffold module for gRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseCRISPR; Mule gateway entry vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
KZ401: pMVP (L3-L2) P2A-Neo + polyA
Plasmid#121781PurposepMVP L3-L2 entry plasmid, contains Neo-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Neo selection marker linked by P2A to gene of interest.DepositorInsertP2A-Neo + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO/FLAG-hPMR1-Tev-Bio
Plasmid#80125PurposeExpresses human PMR1 endonuclease with N-terminal FLAG and C-terminal biotinylation tagsDepositorInsertPXDNL-003 (PXDNL Human)
TagsFLAG and biotinylationExpressionMammalianPromoterCMV promoterAvailable SinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV loxP L5-L2
Plasmid#62094PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a CMV promoter and multiple cloning site flanked by loxP sites. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseCre/Lox; Mule gateway entry vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR SV40 Luc2 (FF-Luciferase) L3-L2
Plasmid#62171PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a SV40 promoter and firefly luciferase module. Compatible with MultiSite Gateway cloningDepositorInsertLuciferase
UseLuciferase; Mule gateway entry vectorExpressionMammalianPromoterSV40Available SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE Lenti Dest Luc2
Plasmid#62179PurposeMuLE (Multiple Lentiviral Expression) Destination vector for use with pMuLE Entry vectors. Co-expresses firefly luciferase under the control of a PGK promoter. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseLuciferase; Mule gateway destination vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
KZ901: pMVP (L3-L2) P2A-eGFP + WPRE
Plasmid#121772PurposepMVP L3-L2 entry plasmid, contains eGFP-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term eGFP linked by P2A to gene of interest in lentivirus vectors.DepositorInsertP2A-eGFP + WPRE
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KZ601: pMVP (L3-L2) P2A-Zeo + polyA
Plasmid#121783PurposepMVP L3-L2 entry plasmid, contains Zeo-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Zeo selection marker linked by P2A to gene of interest.DepositorInsertP2A-Zeo + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRK-HA-TRAF4
Plasmid#58314PurposeHA-tagged mouse TRAF4DepositorAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only