We narrowed to 4,673 results for: pcr
-
Plasmid#174028PurposeThis plasmid is used for generating C-terminal knock-in plasmid and/or PCR donors in zebrafish.DepositorInsertp2A-eGFP
UseZebrafish knock-in taggingAvailable sinceSept. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
gRNA_DNMT3a-T1
Plasmid#41821PurposeExpresses a guide RNA (gRNA) to target DNMT3a (T1 target sequence) for genome engineeringDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA_DNMT3a-T1 (DNMT3A Human)
UseCRISPRExpressionMammalianAvailable sinceJan. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV5 HA-TGFBRII
Plasmid#19158DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTransforming growth factor, beta receptor II (TGFBR2 Human)
TagsHA (YDVPDYASL)ExpressionMammalianMutationPCR based mutagenesisAvailable sinceOct. 1, 2008AvailabilityAcademic Institutions and Nonprofits onlyCited by -
mUAV
Plasmid#102680PurposeMobius Assembly Universal Acceptor Vector, it converts amplified PCR fragments into standard, exchangeable partsDepositorInsertJ23106:B0034:amilCP:rrnBT1-T7TE
UseSynthetic BiologyAvailable sinceMarch 13, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
gRNA_DNMT3b
Plasmid#41823PurposeExpresses a guide RNA (gRNA) to target DNMT3b for genome engineeringDepositorAvailable sinceJan. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
Fret-Stop-Fret TOPO
Plasmid#22774DepositorInsertfret-STOP-fret
ExpressionMammalianAvailable sinceDec. 14, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX52
Plasmid#169444PurposeUsed for guide cloning with PCRDepositorTypeEmpty backboneUseCRISPRAvailable sinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHyg-AID*-6FLAG
Plasmid#99519PurposeC-terminal AID*-6FLAG degron cassette with HygR marker for S. cerevisiaeDepositorAvailable sinceSept. 14, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCBC-MT2T3
Plasmid#50594PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT2, gRNA scaffold, TaU3t plus, U6-26p, T3
UseCRISPR; Pcr templateExpressionPlantAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
gRNA_DNMT3a-T2
Plasmid#41822PurposeExpresses a guide RNA (gRNA) to target DNMT3a (T2 target sequence) for genome engineeringDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA_DNMT3a-T2 (DNMT3A Human)
UseCRISPRExpressionMammalianAvailable sinceJan. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMK262 (RAD21-mAC Neo)
Plasmid#140538PurposeRAD21 tagging with mAID-CloverDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRAD21 (RAD21 Human)
UseCRISPRExpressionMammalianAvailable sinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEPkan-S2
Plasmid#61601PurposePCR template for en passant (two-step Red-mediated) mutagenesisDepositorInsertKana_I-SceI
Available sinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCBC-MT3T4
Plasmid#50595PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT3, gRNA scaffold, U6-26t plus, OsU3p, T4
UseCRISPR; Pcr templateExpressionPlantAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCCM935
Plasmid#58202PurposeExpresses unc-22 sgRNA in C.elegans. Can be used in Co-CRISPR experiments.DepositorInsertunc-22 sgRNA
ExpressionWormPromoterU6Available sinceJuly 30, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTargetAmp
Plasmid#228552PurposeTemplate for PCR amplification for gRNA cloning plasmid by in vivo cloning.DepositorInsertAmpicillin resistance
UseCRISPRAvailable sinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pR26
Plasmid#127372PurposeAllows for doxycycline-inducible gene expression from the murine ROSA26 safe harbor locus upon CRISPR/Cas9-mediated genomic insertion and stable selection.DepositorTypeEmpty backboneUseCRISPR and Mouse TargetingPromotertight TRE promoterAvailable sinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
LentiGuide-BC-EF1a-Puro
Plasmid#127170PurposePCR template for EF1a-puro resistance cassetteDepositorInsertNone
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable sinceAug. 29, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAH5
Plasmid#41829PurposeUsed as a PCR template for tagging yeast proteins with the SNAP tag by homologous recombination and selection for hygromycin resistance.DepositorTypeEmpty backboneUsePcr templateExpressionBacterial and YeastPromoterT7,TEFAvailable sinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
M-SP-sgRNA
Plasmid#48671PurposeMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTGDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter
UseCRISPRPromoterhU6Available sinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
FRP2375
Plasmid#127581PurposeTagging plasmid for WTC 846: Encodes the PtetO7.1 promoter and NAT resistance geneDepositorInsertPtetO7.1_Flagtag_8Glycine linker
UseSynthetic Biology; Pcr based taggingTagsFlag tag, 8glycine linkerAvailable sinceAug. 13, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by