We narrowed to 10,569 results for: cat.1
-
Plasmid#223749PurposeExpression of recombinant protein for purificationDepositorInsertBCL2L13 soluble part (BCL2L13 Human)
UseTagsThrombin cleavage-GSTExpressionBacterialMutationexpresses aa 1-465, with W276A/I279A; deletion of…PromoterAvailable sinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKM154
Plasmid#13036DepositorInsertcat, sacB
UseTagsExpressionBacterialMutationPromoterAvailable sinceOct. 7, 2006AvailabilityAcademic Institutions and Nonprofits only -
-962 human cyclin D1 promoter AP-1 site mutant pGL3Basic
Plasmid#32728DepositorInsertCCND1 promoter (CCND1 Human)
UseLuciferase; Luciferase reporter geneTagsExpressionMutation-947 AP-1 binding site TGAGTCA deletionPromoter-962 CCND1 promoterAvailable sinceJan. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
-962 human cyclin D1 promoter TCF (1) site mutant pGL3Basic
Plasmid#32733DepositorInsertCCND1 promoter (CCND1 Human)
UseLuciferaseTagsExpressionMutation-75 TCF(1) site CTTTGAT deletionPromoter-962 CCND1Available sinceJan. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pB80-hsKIF5B(1-560)Rigor-L-mVenus-L-SspB(micro)
Plasmid#193721PurposeOptogenetic coupling to dimeric human kinesin-1 (KIF5B aa1-807) via SSPB(micro) for anterograde transportDepositorInserthsKIF5B(1-560)Rigor-L-mVenus-L-SspB(micro) (KIF5B Synthetic, Human)
UseTagsmVenus-SSPB(micro)ExpressionMammalianMutationhsKIF5B(aa1-560), RIGOR: G234A; mVenus: Met1Del, …PromoterChicken beta-actinAvailable sinceMarch 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7m-Clover-Geminin(1-110)-IRES-mKO2-Cdt(30-120)
Plasmid#83841PurposeFluorescent probe for G1/S transition and M/G1 transitionDepositorUseLentiviralTagsExpressionMammalianMutationPromoterCMVAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCS4134
Plasmid#131747PurposeHuman reduced folate transporter 1 SLC19A1 for lentiviral transduction, copGFP transduction markerDepositorInsertHuman reduced folate carrier 1 (SLC19A1 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKM402
Plasmid#107770PurposeExpression of phage Che9c RecT for oligo-mediated recombineering in mycobacteriaDepositorInsertsChe9C RecT
TetR (tet repressor)
cat
kan
UseTagsExpressionBacterialMutationPromoterCat promoter, Ptet, kan promoter, and pTB21Available sinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28b-SUMO-FLAG-TeKaiB-1-94-Y8A-Y94A-FLAG
Plasmid#229223PurposeFor expression of T. elongatus KaiB protein mutantDepositorInsertkaiB (kaiB T. elongatus)
UseTagsFLAG and SUMO-FLAGExpressionBacterialMutation1-94 (truncated), Y8A, Y94APromoterAvailable sinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Helios-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75246PurposeCRISPR/Cas9 NICKASE plasmid against human Helios (1/2)DepositorInsertsgRNA against human Helios (IKZF2 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSico_U6-Pan-PGC1a sgRNA
Plasmid#165426PurposeExpression of gRNA against human Total PGC-1a variantsDepositorInsertgRNA against human Total PGC-1a variants (PPARGC1A Synthetic, Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceApril 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Afp
Plasmid#99696PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Afp, vector allows for strong activation of mouse Afp, can be packaged and delivered as AAVDepositorInsertdCas9 and gRNA targeting Afp (Afp Synthetic)
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
SG3ΔENV CA E45A
Plasmid#145783PurposeNon-infectious HIV-1 Clone with stop codon in Env (see NIH AIDS Reagent Program Cat #11051) and E45A mutation in capsid (CA E45A).DepositorInsertCapsid
UseLentiviral and RetroviralTagsExpressionMammalianMutationChanged Capsid residue glutamic acid 45 to alanin…PromoterAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
SG3ΔENV CA M66I
Plasmid#149687PurposeNon-infectious HIV-1 Clone with stop codon in Env (see NIH AIDS Reagent Program Cat #11051) and M66I mutation in capsid (CA M66I).DepositorInsertCapsid
UseLentiviral and RetroviralTagsExpressionMammalianMutationChanged Capsid residue Met 66 to Iso (CA M66I)PromoterAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (Hbb Synthetic)
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
p36-p37-p38-p40-pET-Duet-1-Rfc3-T76D
Plasmid#175051PurposeOverexpression of human Rfc2,Rfc3-3KtoA,Rfc4,Rfc5 in E.coliDepositorUseTagsExpressionBacterialMutationchanged Thr76 to Asp, phosphomimetic mutationPromoterT7 promoterAvailable sinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
p36-p37-p38-p40-pET-Duet-1-Rfc3-3KtoA
Plasmid#175050PurposeOverexpression of human Rfc2,Rfc3-3KtoA,Rfc4,Rfc5 in E.coliDepositorUseTagsExpressionBacterialMutationPromoterT7 promoterAvailable sinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-Dual_BNIP3(1-158aa)-THROMBIN-GST (W18A/L21A; deltaLIR)
Plasmid#223778PurposeExpression of recombinant protein for purificationDepositorInsertBNIP3 soluble part (BNIP3 Human)
UseTagsThrombin cleavage-GSTExpressionInsectMutationW18A/L21A; deletion of LIRPromoterAvailable sinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETDuet1_NIX(1-182aa)-EGFP-TEV-GST (W36A/L39A; deltaLIR)
Plasmid#223748PurposeExpression of recombinant protein for purificationDepositorInsertNIX (BNIP3L) soluble part (BNIP3L Human)
UseTagsEGFP-TEV-GSTExpressionBacterialMutationW36A/L39A; deletion of LIRPromoterAvailable sinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only