1,904 results
-
Plasmid#200043PurposePrig-3 FRT let858 (stop) FRT zif-1 SL2 EBFP unc-54 3' UTR C.elegans AVA and other neurons expression of zif EBFPDepositorAvailable SinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS110
Plasmid#215674PurposeSplit hygromycinR landing pad insertion plasmid for ChrIIIDepositorInsert5'HA + synthetic guide site3 + 3'ΔHygR:unc-54 3' UTR + lox2272 + SEC + lox2272 + 3'HA
UseCRISPR and Cre/LoxExpressionWormMutation3' ∆HYGR is promoterless and encodes aa60-341Available SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSAH64 - [AFDp | gfp | tbb-2 UTR]
Plasmid#200338Purposegfp BioPart for AFD neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AFDp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00001535, gcy-8Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDV06 [punc-17::SNG-1::CRY2(535)]
Plasmid#197597PurposeExpression of SNG-1::CRY2olig(535) in cholinergic motor neurons of C. elegansDepositorExpressionWormMutationE490GAvailable SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT348
Plasmid#204515PurposeBacterial expression of CEC-5 C-terminal fragment with 6xHis and maltose binding protein tags for use as an antigenDepositorInsertC-terminal fragment of cec-5 (C. elegans)
Tags6xHis, MBPExpressionBacterialPromoterT7lacAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH50 - [PVQp | gfp | tbb-2 UTR]
Plasmid#200326Purposegfp BioPart for PVQ neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[PVQp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00003755, nlp-17Available SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH47 - [ADLp | mScarlet | tbb-2 UTR]
Plasmid#200323PurposemScarlet BioPart for ADL neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[ADLp | wrmscarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00011644, T09B9.3Available SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH80 - [AWAp | gfp | tbb-2 UTR]
Plasmid#200354Purposegfp BioPart for AWA neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AWAp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00006109, str-44Available SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH83 - [AVHp | wrmScarlet | tbb-2 UTR]
Plasmid#200357PurposemScarlet BioPart for AVH neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AVHp | wrmScarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00011327, hlh-34Available SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH79 - [AWAp | wrmScarlet | tbb-2 UTR]
Plasmid#200353PurposemScarlet BioPart for AWA neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AWAp | wrmScarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00006109, str-44Available SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH63 - [AFDp | wrmScarlet | tbb-2 UTR]
Plasmid#200337PurposemScarlet BioPart for AFD neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AFDp | wrmScarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00001535, gcy-8Available SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZCS41 (U6p::GCGAAGTGACGGTAGACCGT)
Plasmid#193050PurposeEncodes guide RNA expression targeting PX740 landing padDepositorInsertGuide RNA
UseCRISPRExpressionWormPromoterU6Available SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB91
Plasmid#199319PurposeCombine with Gal4 to direct ACR1 expressionDepositorInsert15xUAS::delta pes-10::::ACR1::let-858 3'UTR
ExpressionWormPromoter15xUAS::delta pes-10Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB88
Plasmid#199321PurposeCombine with Gal4 to direct TeNL expressionDepositorInsert15xUAS::delta pes-10::::TeNL::let-858 3'UTR
ExpressionWormMutationKD for calcium is 250 nM, 1 synthetic intronPromoter15xUAS::delta pes-10Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB109
Plasmid#199322PurposeCombine with Gal4 to direct CaMBI 300 expressionDepositorInsert15xUAS::delta pes-10::::CaMBI::let-858 3'UTR
ExpressionWormMutationOrange CaMBI with 300 nM KD for calciumPromoter15xUAS:::delta pes-10Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB96
Plasmid#199316PurposeMosSCI insertion of flp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR at ttTi5605DepositorInsertflp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR
ExpressionWormMutationmTagBFP2 from pJJR81, C. elegans codon optimized …Promoterflp-18Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT353
Plasmid#204506PurposeIn vitro transcription of RNA probes for in situ hybridization of CeRep55 lncRNAs in nematode (after linearization with NotI and BglI)DepositorInsertCeRep55 tandem repeats from Y73B3A (C. elegans)
UseOtherPromoterdouble-T7Available SinceAug. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT346
Plasmid#204505Purpose5S rDNA used as a probe for chromosome FISH in nematodeDepositorInsert5S rDNA (C. elegans)
UseOtherPromoterT7Available SinceAug. 15, 2023AvailabilityAcademic Institutions and Nonprofits only