We narrowed to 4,390 results for: gca
-
Plasmid#100020PurposeBacterial expression of fluorescent reporter for calcium signaling, based off of GCaMP6s. Contains a stable reference Large Stokes Shift (LSS) mOrange nested within the reporting superfolder cpGFP.DepositorInsertsfMatryoshCaMP6s
Tags6x HIS tag and Xpress_EK tagExpressionBacterialMutationcpEGFP replaced with superfolder cpGFPPromoterT7Available SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
PPP2R5D B12.5 gRNA
Plasmid#90854Purpose3rd generation lentiviral gRNA plasmid targeting human PPP2R5DDepositorInsertPPP2R5D (Guide Designation B12.5)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAS19
Plasmid#158788PurposeRibosome-tagged GCaMP (soma localized) expression in C. elegans ASH neuronsDepositorInsertpsra-6::GCaMP6m::rpl-1a
ExpressionWormAvailable SinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAS16
Plasmid#158786PurposeRibosome-tagged GCaMP (soma localized) expression in C. elegans AFD neurons (and others)DepositorInsertPntc-1::GCaMP6m::rpl-1a
ExpressionWormAvailable SinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
BUB3 A10.1 gRNA
Plasmid#90557Purpose3rd generation lentiviral gRNA plasmid targeting human BUB3DepositorInsertBUB3 (Guide Designation A10.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTol1-U6abc_tnnt2a_cmlc2-nmKate
Plasmid#238309PurposeDrives expression of 3 different gRNAs targeting tnnt2a, and expression of nuclear mKate in cardiomyocytes.DepositorInsertnuclear mKate/3 gRNAs targeting tnnt2a
Promotercmlc2 (nmKate); U6 (gRNAs)Available SinceNov. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459_LIG4_Exon3
Plasmid#225363PurposepX459 plasmid encoding the sgRNA protospacer sequence “5’-GCATAATGTCACTACAGATC-3’ to target the LIG4 gene.DepositorAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-3mer-35kb-DSF
Plasmid#227492Purpose3-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.luxR(mut)-sggfp(A)
Plasmid#236039PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(A) expresses the dCas12a endonuclease and the sgRNA (design A) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
VirTREX2-HLDel-1_NbATML1-1pro
Plasmid#231149PurposeT-DNA encoding TRV2 with TREX2 and mobile gRNA targeting NbATML1-1proDepositorInsertTREX2 and mobile gRNA targeting NbATML1-1pro
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgMTHFD1
Plasmid#217436PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human MTHFD1DepositorInsertsgRNA targeting MTHFD1 (MTHFD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDY2259 hNOLC1 atgRNA Paired Guide 1
Plasmid#220989PurposehNOLC1 atgRNADepositorInsertNOLC1 atgRNA (NOLC1 Human)
UseCRISPRAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY2260 hNOLC1 atgRNA Paired Guide 2
Plasmid#220990PurposehNOLC1 atgRNADepositorInsertNOLC1 atgRNA (NOLC1 Human)
UseCRISPRAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY2262 hACTB atgRNA Paired Guide 2
Plasmid#220992PurposehACTB atgRNADepositorInsertACTB atgRNA (ACTB Human)
UseCRISPRAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xPax7gRNA
Plasmid#224570PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)MutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-3xGFP11-mem-3xPax7gRNA
Plasmid#224571PurposeUbiquitous expression plasmid with CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage, three membrane split GFP(11) reporter.DepositorInsert3xGFP11
UseCRISPRTagsMembrane Localization SignalMutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only