We narrowed to 15,025 results for: NTS
-
Plasmid#74815PurposeGateway cloning compatible binary vector for N-terminal fusion with 10xMyc (CaMV35S promoter).DepositorTypeEmpty backboneExpressionPlantPromoterCaMV35SAvailable SinceOct. 18, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pMP71-tCD19-LLO-SIINFEKL
Plasmid#174598Purposeexpresses the extracellular and transmembrane domain of murine CD19 with a C terminal fusion of the LLO190 and SIINFEKL epitopesDepositorInsertmembrane bound CD19, LLO antigen, SIINFEKL (ovalbumin) antigen
ExpressionMammalianAvailable SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
GalT-moxDendra2
Plasmid#89789Purposemammalian expression of GC localized moxDendra2DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
(326) pAAV SV40-ZsGreen U6-gRNA
Plasmid#163020PurposeFluorescent reporter for Sa gRNA (Bsa1 sites)DepositorInsertZs Green
UseAAVExpressionMammalianPromoterSV40Available SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMOD_A0402
Plasmid#91009PurposeModule A, Promoter: AtUbi10, Gene: AtCas9_dead (D10A + H840A), Terminator: HSPDepositorInsertAtCas9_dead (D10A + H840A)
UseCRISPRMutationD10A, H840APromoterAtUbi10Available SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTX209
Plasmid#89269PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA01 and OsPDS-gRNA02DepositorInsertOsPDS-gRNA01 and OsPDS-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDGE479
Plasmid#153270PurposeM4E shuttle vector containing the Solanum lycopersicum U3 promoter for preparation of single guide RNA transcriptional units by cloning of hybridized oligonucleotides.DepositorTypeEmpty backboneUseCRISPRAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_attR1-ORF-attR2-NTEV-TCS-GV-2xHA_DEST
Plasmid#194385PurposeGateway Destination vector for split TEV assaysDepositorInsertattR1-ORF-attR2-NTEV-TCS-GV-2xHA
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGE331
Plasmid#153240PurposeM1E shuttle vector containing the Arabidopsis thaliana U6 promoter for preparation of single guide RNA transcriptional units by cloning of hybridized oligonucleotides.DepositorTypeEmpty backboneUseCRISPRAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only