We narrowed to 6,812 results for: KIT;
-
Plasmid#55202PurposePlasmid encoding multiplexed 4x gRNAs. This is a modified form of the original plasmid described in the paper (Construct 19). mKate2 was replaced with dsRed2 because of distribution issues.DepositorInsertdsRed2
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
pJH127
Plasmid#162483PurposeSEC plasmid containing LG1 homology arms and myo-2p::TIR1::F2A::BFP::AID*::NLS::tbb-2 3'UTR, for expression of TIR1 and nuclear BFP reporter in C. elegans.DepositorInsertmyo-2p::TIR1::F2A::AID*::NLS::tbb-2 3'UTR
UseCRISPRTagsmyo-2p::TIR1::F2A::AID*::NLS::tbb-2 3'UTRExpressionWormAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
GABA(A) receptor subunit B3SE
Plasmid#49171PurposepHluorin-tagged GABA A receptor subunit (beta 3) produces minimal fluorescence during trafficking and a robust fluorescent signal at the cell surfaceDepositorInsertGABA(A) receptor subunit beta 3 (Gabrb3 Mouse)
Tagsmyc, pHGFP (pHluorin), and thrombin cleavage site…ExpressionMammalianMutationGTG (V) to TGC (C)PromoterCMVAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcU6_3 MS2 sgRNA
Plasmid#92394PurposeChick-specific U6 sgRNA expression mini-vector, harbouring chick U6_3 pol III promoter, with tracrRNA scaffold containing stem loops allowing binding of bacteriophage MS2 coat protein MCPDepositorInsertchick U6.3 promoter and gRNA cloning cassette including MS2 stem loops
UseCRISPRExpressionMammalianPromoterchick U6.3Available SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJH130
Plasmid#162484PurposeSEC plasmid containing LG1 homology arms and myo-3p::TIR1::F2A::BFP::AID*::NLS::tbb-2 3'UTR, for expression of TIR1 and nuclear BFP reporter in C. elegans.DepositorInsertmyo-3p::TIR1::F2A::AID*::NLS::tbb-2 3'UTR
UseCRISPRTagsmyo-3p::TIR1::F2A::AID*::NLS::tbb-2 3'UTRExpressionWormAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
MAC-CTSS
Plasmid#172415PurposeMAC-tagged gene expressionDepositorAvailable SinceNov. 4, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR P4-P1R-EGFP
Plasmid#48348PurposeContributes the coding sequence for EGFP as the 5’-module during MultiSite Gateway-cloning of chimeric cDNAs encoding three-part fusion proteins.DepositorInsertEGFP
UseGateway entry vectorMutationContains a Kozak sequence. Does not contain a sto…PromoternoneAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBUN6A11
Plasmid#50579PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-VP64, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInsertsdCas9-VP64
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 = defective in DNA cleavage; 4×minimal VP16…PromoterOsU3p and Ubi1pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only