We narrowed to 2,922 results for: GFP reporter gene
-
Plasmid#225587PurposeMammalian expression vector for TRIM21 RING-vhhGFP4 anti-GFP degrader with a self-cleaving T2A-mCherry fluorescent expression reporterDepositorInsertT21R-vhhGFP4-T2A-mCherry
TagsmCherryExpressionMammalianPromoterCMVAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLX304 Flag-mCherry-eEF1A1_IRES-GFP
Plasmid#198383PurposeeEF1A1 fluorescent reporterDepositorAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
phage UbiC NLS HA stdPCP stdGFP
Plasmid#104099PurposeLentiviral vector expressing synonymous tandem PP7 coat protein fused to synonymous tandem GFP. Used to label reporter mRNAs.DepositorInsertstdPCP-stdGFP
UseLentiviralTagsN-terminal NLS, Two synonymous copies of GFP (C-t…ExpressionMammalianAvailable SinceDec. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRaGE Pyl TAG GFP Y35TAG
Plasmid#160041PurposeEncodes for MmPyl tRNA synthetase/tRNA pair and for GFP reporter with TAG mutation at site 35, for unnatural amino acid incorporation into the GFP protein in Vibrio natriegens.DepositorInsertsPyrrolysyl tRNA synthetase (Methanosarcina mazei)
Pyrrolysyl tRNA(cua) (Methanosarcina mazei)
deGFP
UseSynthetic BiologyTagsHis-tagExpressionBacterialMutationChanged tyrosine 35 to TAG stop-codon (Site numbe…PromoterP70b promoter and T500 terminator, Vibrio natrieg…Available SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPB-Neo-COVGT5-d2EGFP-mCherry
Plasmid#201454PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT5_d2EGFP
UseSynthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1a-hLMX1A-T2A-copGFP
Plasmid#170444PurposeLentiviral vector expressing human LMX1A (with silent mutation) with copGFP reporter gene, under control of EF1alpha promoter.DepositorInserthuman LMX1A
UseLentiviralPromoterEF1aAvailable SinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(WT)-mascRNA](pAVA2965)
Plasmid#239351PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of wild-type MALAT1 ENE-mascRNA reporter.DepositorInsertMALAT1 ENE(WT)-mascRNA
ExpressionMammalianAvailable SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
SCN1Aprom(335-406)-H2B-GFP
Plasmid#236151PurposeFluorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with the SCN1a promoter region encompassing 335 to 406 bp upstream of its transcriptional start siteDepositorInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianPromoterE1b minimal promoter with the SCN1a promoter regi…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPRKCZ-C20-EGFP (C-PRKCZ-C20)
Plasmid#217761PurposeFluorescent reporter for ceramide (putative, mammalian expression)DepositorInsertProtein kinase C zeta (PRKCZ Human)
TagsEGFPExpressionMammalianMutationC20 domain (aa 405-592)PromoterCMVAvailable SinceJune 11, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPB-Neo-COVGT1-d2EGFP-mCherry
Plasmid#201451PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT1_d2EGFP-mCherry
UseSynthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-Neo-COVGT2-d2EGFP-mCherry
Plasmid#201452PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT2_d2EGFP-mCherry
UseSynthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-Neo-COVGT4-d2EGFP-mCherry
Plasmid#201453PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT4_d2EGFP-mCherry
UseSynthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
IX702: pMVP (L3-L2) OLLAS-IRES-eGFP + polyA
Plasmid#121748PurposepMVP L3-L2 entry plasmid, contains OLLAS epitope tag + IRES2-eGFP + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion and IRES expression of eGFP reporterDepositorInsertOLLAS epitope tag-IRES2-eGFP + polyA
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-DDdCas9VPH-T2A-GFP-IRES-Neo
Plasmid#102886PurposePiggyBac transposon system construct with constitutive CAG promoter expression of TMP inducible DDdCas9VP192-p65-HSF1 activator followed by T2A-EGFP as a reporter and IRES-Neo as selectionDepositorInsertDDdCas9VP192-p65-HSF1-T2A-GFP-IRES-Neo
UseCRISPRExpressionMammalianMutationD10A, H840APromoterCAGAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-tight-DDdCas9VPH-T2A-GFP-IRES-Neo
Plasmid#102890PurposePiggyBac construct with doxycyline inducible TRE-tight promoter expression of TMP inducible DDdCas9VP192-p65-HSF1 activator followed by T2A-EGFP as a reporter and IRES-Neo as selectionDepositorInsertDDdCas9VP192-p65-HSF1-T2A-GFP-IRES-Neo
UseCRISPRExpressionMammalianMutationD10A, H840APromoterTRE-tightAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-tight-DDdCas9VP192-T2A-GFP-IRES-Neo
Plasmid#102889PurposePiggyBac transposon system construct with doxycyline inducible TRE-tight promoter expression of TMP inducible DDdCas9VP192 activator followed by T2A-EGFP as a reporter and IRES-Neo as selectionDepositorInsertDDdCas9VP192-T2A-GFP-IRES-Neo
UseCRISPRExpressionMammalianMutationD10A, H840APromoterTRE-tightAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-DDdCas9VP192-T2A-GFP-IRES-Neo
Plasmid#102885PurposePiggyBac transposon system construct with constitutive CAG promoter expression of TMP inducible DDdCas9VP192 activator followed by T2A-EGFP as a reporter and IRES-Neo as selectionDepositorInsertDDdCas9VP192-T2A-GFP-IRES-Neo
UseCRISPRExpressionMammalianMutationD10A, H840APromoterCAGAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-DDdCas9VPP300-T2A-GFP-IRES-Neo
Plasmid#102887PurposePiggyBac transposon system construct with constitutive CAG promoter expression of TMP inducible DDdCas9VP192-P300core activator followed by T2A-EGFP as a reporter and IRES-Neo as selectionDepositorInsertDDdCas9VP192-P300-T2A-GFP-IRES-Neo
UseCRISPRExpressionMammalianMutationD10A, H840APromoterCAGAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HR donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97309PurposeHR donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HR donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only