We narrowed to 7,192 results for: aav
-
Plasmid#196681PurposeRep/Cap plasmid for the production of M.Mus.1, an AAV capsid with CNS tropism in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationWVLPSGG insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MDV1B
Plasmid#196680PurposeRep/Cap plasmid for the production of MDV1B, an AAV capsid with CNS tropism in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationKTVGTVY insert between amino acids 588 and 589 of…Promoterp41Available SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-fSFRP2-GFP
Plasmid#22915DepositorInsertfugu secreted frizzled receptor protein 2 promoter driving GFP
UseAAVExpressionMammalianAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb NHEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97310PurposeNHEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb NHEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-PAL2
Plasmid#196691PurposeRep/Cap plasmid for the production of PAL2, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationPTQGTVR insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-mNeonGreen
Plasmid#191208PurposemNeonGreen expression under the control of TRE promotorDepositorInsertmNeonGreen
UseAAVExpressionMammalianPromoterTREAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_Donor/Reporter-COL4A5
Plasmid#130280PurposeCOL4A5 mutation-specific sgRNA under the control of U6 promoter; mCherry-sgRNA target-(out of frame)EGFP expression cassette; COL4A5 donor templateDepositorInsertmCherry-eGFP
UseAAVPromoterCMVAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAVsc.U6-sgFah.CMV/CB-EGFP
Plasmid#121508PurposeExpresses sgRNA targeting mouse Fah intron 7 (sgFah).DepositorInsertsgFah
UseAAVExpressionMammalianPromoterU6Available SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn_TALEBB(NI)-NLS-SID4X_2A_phiLOV2.1_WPRE_bGHpA
Plasmid#47452PurposeAAV TALE synthesis backbone with NI half repeat; fused to nuclear localization sequence linker and SID4X transcriptional repressor effector domain. Synapsin promoter for neuronal expression.DepositorInsertTALE BB(N136_0.5NI_C63)-SID4X
UseAAV; TaleTags2A_phiLOV2.1ExpressionMammalianPromoterhSyn human synapsin (mammalian neuronal expressio…Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn_TALEBB(HD)-NLS-VP64_2A_GFP_WPRE_bGHpA
Plasmid#47446PurposeAAV TALE synthesis backbone with HD half repeat; fused to nuclear localization sequence linker and VP64 transcriptional activator effector domain. Synapsin promoter for neuronal expression.DepositorInsertTALE BB(N136_0.5HD_C63)-VP64
UseAAV; TaleTags2A_GFPExpressionMammalianPromoterhSyn human synapsin (mammalian neuronal expressio…Available SinceOct. 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn_TALEBB(NN)-NLS-VP64_2A_GFP_WPRE_bGHpA
Plasmid#47445PurposeAAV TALE synthesis backbone with NN half repeat; fused to nuclear localization sequence linker and VP64 transcriptional activator effector domain. Synapsin promoter for neuronal expression.DepositorInsertTALE BB(N136_0.5NN_C63)-VP64
UseAAV; TaleTags2A_GFPExpressionMammalianPromoterhSyn human synapsin (mammalian neuronal expressio…Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pPROBE'-gfp[AAV]
Plasmid#40169DepositorInsertPromotor probe
Available SinceDec. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAVf-EnhCB-lacZnls
Plasmid#35642DepositorTypeEmpty backboneUseAAVAvailable SinceApril 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CamKII-GFP
Plasmid#182737PurposeGFP expression under the control of CamKII promotorDepositorInsertGFP
UseAAVPromoterCamKIIAvailable SinceApril 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
LITE1.0_pAAV_hSyn_CRY2PHR-NLS-VP64_2A_GFP_WPRE_bGHpA
Plasmid#48253PurposeLITE1.0 CRY2PHR fused to VP64 transcriptional activator domain. Binds to CIB1 upon blue light stimulation. Synapsin promoter for neuronal expression. See LITE2.0 for optimized LITE activators.DepositorInsertCRY2PHR-NLS-VP64
UseAAV; TaleTags2A_GFPExpressionMammalianPromoterEF1-alphaAvailable SinceOct. 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-fTCAP-GFP
Plasmid#22916DepositorInsertfugu titan cap promoter driving GFP
UseAAVExpressionMammalianAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
J7AAV-HDR Fah.2
Plasmid#73451PurposeJ7AAV-HDR U6sgFah.2 template2 to repair Fah mutationDepositorInsertFah (Fah Mouse)
UseAAVAvailable SinceFeb. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Hyg-FHIT
Plasmid#16410DepositorAvailable SinceApril 24, 2008AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA 27
Plasmid#132396PurposeTargets AAVS1 intron 1, gRNA: ACCCCACAGTGGGGCCACTA, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-EGFPKir7.1
Plasmid#107182PurposeAdenoassociatedvirus particle generationDepositorAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only