We narrowed to 11,153 results for: streptococcus -(crispr) -(cas9)
-
Plasmid#254536PurposeCDC7 knockoutDepositorAvailable SinceMay 11, 2026AvailabilityAcademic Institutions and Nonprofits only
-
dCas9-FCPF
Plasmid#220131PurposeExpresses dCas9-FCPF in mammalian cellsDepositorAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-dCas9-FCPF
Plasmid#220133PurposeExpresses dCas9-FCPF in E.coliDepositorInsertdCas9-FCPF (cas9 Synthetic, S. pyogenes)
Tags6xHisExpressionBacterialMutationFCPF sequence inserted on C-terminalPromoterT7Available SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Blast
Plasmid#83480PurposeMammalian expression of Cas9 and sgRNA scaffoldDepositorInsertBlasticidin S deaminase
UseCRISPR and LentiviralExpressionMammalianMutationReplaced puromycin N-acetyltransferase on the ori…PromoterEF-1αAvailable SinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
OmEF1aCas9P2ApuroSB
Plasmid#165484PurposeStable expression of a zebrafish optimized Cas9 driven by a tilapia promoter in fish cellsDepositorInsertZebrafish optimized Cas9 (nls-zcas9-nls from Wenbiao Chen Lab plasmid pCS2-nCas9n Addgene #47929)
UseCRISPR; TransposonPromoterOreochromis mossambicus EF1 alpha promoter (OmEF1…Available SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDmAct5C::Cas9-2A-Neo
Plasmid#176679PurposeExpression of Drosophila codon optimized spCas9 under Drosophila Act5C promoterDepositorInsertspCas9; NeoR (aminoglycoside phosphotransferase from Tn5)
UseCrisprExpressionInsectMutationDrosophila codon optimizedPromoterD. melanogaster Act5CAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-BbsI-chiRNA
Plasmid#45946PurposePlasmid for expression of chiRNA under the control of the Drosophila snRNA:U6:96Ab promoter.DepositorInsertU6-BbsI-chiRNA
UseCRISPRExpressionInsectPromoterDm-snRNA:U6:96AbAvailable SinceJune 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_2-As
Plasmid#209032PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_3-As
Plasmid#209033PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_1-Lb
Plasmid#209027PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_2-Lb
Plasmid#209028PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_3-Lb
Plasmid#209029PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_1-As
Plasmid#209031PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-NM
Plasmid#48679PurposeMammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET28a(+)-SpdCas9-LBiT_Strep-Tag-II
Plasmid#198751PurposeExpresses S. Pyogenes dCas9 fused to LargeBiT fragment of split NanoLuc luciferaseDepositorInsertSpdCas9 - LargeBiT
TagsStrep-tag IIExpressionBacterialMutationD10A, H840A (nuclease inactivating mutations in &…PromoterT7Available SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAT9748-dCBE
Plasmid#163008Purposeplasmid expressing CBE with dCas9DepositorInsertdCBE
UseCRISPRTags3xFLAG and SV40 NLSExpressionMammalianPromoterEF1-aAvailable SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
PX330-PTEN
Plasmid#227440PurposeCas9 expression and a gRNA targeting Exon 6 of mouse PTENDepositorInsertspCas9 and gRNA for mouse PTEN (Pten )
ExpressionMammalianAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28a(+)-SpdCas9-SBiT_Strep-Tag-II
Plasmid#198750PurposeExpresses S. Pyogenes dCas9 fused to SmallBiT fragment of split NanoLuc luciferaseDepositorInsertSpdCas9 - SmallBiT
TagsStrep-tag IIExpressionBacterialMutationD10A, H840A (nuclease inactivating mutations in &…PromoterT7Available SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMM178
Plasmid#61270PurposeAlso referred to as pRGNndm-1. Expresses Cas9, tracrRNA and a guide RNA which target the NDM-1 gene. Contains a pBBR1 origin and chloramphenicol resistance.DepositorInsertCas9, tracrRNA, crRNA
UseCRISPRTags6xHisExpressionBacterialPromoterpLtetO, native, native (respectively)Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-SP-Cas9 reporter
Plasmid#62733PurposeMammalian CRISPR-SP-Cas9 reporterDepositorInsertCRISPR-SP-Cas9 target seq + tdTomato (out of frame)
UseCRISPR and LentiviralTagsCRISPR-SP-Cas9 target seq (hAAVS1 locus) and HA t…ExpressionMammalianPromoterEF1-AlphaAvailable SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only