We narrowed to 1,760 results for: zan
-
Plasmid#233256PurposeExpression of BFP-tagged ARF6 WT for Turbo ID experimentsDepositorInsertARF6 (ARF6 Human)
UseLentiviralAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQCXIH FRB Ubiqutin-BFP
Plasmid#202426PurposeTagBFP FKBP-rapamycin binding (FRB) dimerization domain fused to ubiquitinDepositorInsertFKBP-rapamycin binding (FRB) dimerization domain
UseLentiviralTagsUbiquitin, TagBFPAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLEX304-ARF5-T161A-mNeonGreen
Plasmid#162026PurposeFast cycling ARF mutantDepositorAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZIP-hCMV-ZsGreen-P2A-Puro-IKZF3 sh1
Plasmid#123326PurposeLentiviral vector for expression of shRNA targeting IKZF3 from a miR30 embedded casette in the 3'UTR of ZsGreen-P2A-Puro insertDepositorInsertshRNA targeting IKZF3 embedded in miR30 backbone (IKZF3 Human)
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZIP-hCMV-ZSGreen-P2A-Puro-IKZF3 sh2
Plasmid#123327PurposeLentiviral vector for expression of shRNA targeting IKZF3 from a miR30 embedded casette in the 3'UTR of ZsGreen-P2A-Puro insertDepositorInsertshRNA targeting IKZF3 embedded in miR30 backbone (IKZF3 Human)
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLC-Flag-CSNK1A1 G40N-P2A-Blast
Plasmid#123321PurposeLentiviral vector for expression of Flag tagged CK1alpha G40N-P2A-Blast casette from a CMV promoterDepositorInsertCSNK1A1 (CSNK1A1 Human)
UseLentiviralTagsFlagExpressionMammalianMutationchanged Glycine 40 to AsparaginePromoterCMVAvailable SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
ACA8-mYFP
Plasmid#87245Purposefluorescent labelling of ACA8DepositorAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
ACA8-YFPc
Plasmid#87243Purposefluorescence complementation assayDepositorAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
ACA8-YFPn
Plasmid#87241Purposefluorescence complementation assayDepositorAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTH731-2µ-RLuc/minCFLuc
Plasmid#40601DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn CaBLAM
Plasmid#244227PurposeBioluminescent reporter for calcium signaling in neuronsDepositorInsertsmNeonGreen
CaBLAM
UseAAVAvailable SinceNov. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gGFP)-PGKmCherry2AGFP-W
Plasmid#67982PurposeCas9 activity reporter with mCherry and GFPDepositorInsertU6gRNA cassette, PGKmCherry2AGFP cassette, WPRE
UseCRISPR and LentiviralMutationDeleted BbsI site within WPREAvailable SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gGFP)-PGKBFP2AGFP-W
Plasmid#67980PurposeCas9 activity reporter with BFP and GFP.DepositorInsertU6gRNA cassette, PGKBFP2AGFP cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV GFAP CaBLAM
Plasmid#244228PurposeBioluminescent reporter for calcium signaling in astrocytesDepositorInsertsmNeonGreen
CaBLAM
UseAAVAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pWZL-Neo-Myr-Flag-DEST
Plasmid#15300Purposea Gateway-compatible retroviral destination vector which adds a myristoylation sequence and a FLAG tag to each introduced ORFDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseRetroviralTagsFlag and MyrExpressionMammalianAvailable SinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDH-kz-CD20-Puro
Plasmid#209759PurposeLentiviral transfer plasmid to express the CDS of the human CD20 gene, MS4A1.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV2 Nucleocapsid
Plasmid#153201PurposeExpresses myc-tagged nucleocapsid (N) from SARS-CoV2 in mammalian cellsDepositorInsertNucleocapsid from SARS-CoV-2 (N severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2))
TagsMyc tag (5X)ExpressionMammalianPromoterCMVAvailable SinceJuly 15, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
TDP-REGv2(Gaussia Luciferase)#5 in pTwist-CMV
Plasmid#216164PurposeExpression of secreted Gaussia Luciferase specifically in cells with TDP-43 loss of function. Note: It is not recommended to produce lentiviruses containing TDP-REG sequences – see Depositor CommentsDepositorInsertGaussia princeps luciferase (with double mutation to improve stability)
ExpressionMammalianAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only